Nucleic acid construct for endogenously expressing RNA polymerase in cells

A technology of nucleic acid constructs and constructs, applied in the direction of recombinant DNA technology, enzymes, microorganisms, etc., can solve problems such as impact and bad

Pending Publication Date: 2019-03-05
KANGMA SHANGHAI BIOTECH LTD
View PDF3 Cites 35 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In existing literature reports and commercial kits, the T7 RNAP protein is added manually through exogenous sources, including the Escherichia coli system ( E. coli extract, ECE), rabbit reticulocyte Lysate (RRL), wheat germ (Wheat germ extract, WGE), insect (Insect cell extract, ICE) and human-derived systems, which have great influence on experimental efficiency, cost, complexity and stability sex is bad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid construct for endogenously expressing RNA polymerase in cells
  • Nucleic acid construct for endogenously expressing RNA polymerase in cells
  • Nucleic acid construct for endogenously expressing RNA polymerase in cells

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0090] In the present invention, the preparation method of the yeast cell extract is not limited, and a preferred preparation method includes the following steps:

[0091] (i) providing yeast cells;

[0092] (ii) washing the yeast cells to obtain washed yeast cells;

[0093] (iii) subjecting the washed yeast cells to destructive treatment to obtain crude yeast extract;

[0094] (iv) performing solid-liquid separation on the crude yeast extract to obtain the liquid part, which is the yeast cell extract.

[0095] In the present invention, the solid-liquid separation method is not particularly limited, and a preferred method is centrifugation.

[0096] In a preferred embodiment, said centrifugation is performed in a liquid state.

[0097] In the present invention, the centrifugation conditions are not particularly limited, and a preferred centrifugation condition is 5000-100000×g, preferably 8000-30000×g.

[0098] In the present invention, the centrifugation time is not parti...

Embodiment 1

[0158] The selection of the insertion site in the cell genome of embodiment 1

[0159] In order to overcome the defect of exogenous manual addition of T7 RNA polymerase protein in the existing in vitro translation system, the present invention integrates T7 RNAP protein into the cell genome through gene editing technology, and creates a strain that can stably express T7 RNAP protein in an appropriate amount. Thus, a simple and efficient in vitro translation system without exogenous manual addition of T7 RNAP was formed.

[0160] The in vitro translation system has high requirements on the content of T7 RNAP, too high or too little will affect the efficiency of the system. Therefore, the present invention inserts a weaker pScRNR2 promoter before T7RNAP, constructs the structure into an episomal plasmid, and verifies the function of the T7 RNAP expression cassette in an in vitro translation system.

[0161] After the functional verification of the episomal plasmid, the present ...

Embodiment 2

[0162] Example 2 Construction of pKM-T7RNAP1 plasmid, yeast transformation and activity determination

[0163] 2.1 Construction of pKM-T7RNAP1 plasmid

[0164] In order to verify that T7 RNAP can be effectively expressed in cells and has transcriptional activity, the present invention first constructs T7 RNAP episomal plasmids and transforms cells. The promoter of T7 RNAP in the free plasmid is ScRNR2 promoter, the terminator is ScCYC1terminator, and the resistance gene is Kan . Plasmid construction and transformation methods are as follows:

[0165] Using the plasmid containing the T7 RNAP gene as a template, primers PF1: ATGAACACGATTAACATCGCTAAGAACG (SEQ ID NO.: 2) and PR1: TTACGCGAACGCGAAGTCCG (SEQ ID NO.: 3) were used for PCR amplification; Kluyveromyces lactis episomal plasmid was used as a template, PCR amplification was performed with primers PF2: ATCTTAGAGTCGGACTTCGCGTTCGCGTAAGAAGATGCTTCTGCTCATCATC (SEQ ID NO.: 4) and PR 2: AGTCGTTCTTAGCGATGTTAATCGTGTTCATGGTAATTGGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a nucleic acid construct for endogenously expressing RNA polymerase in cells, and particularly discovers a novel nucleic acid construct capable of greatly enhancing protein translation efficiency. The nucleic acid construct consists of a promoter with specific promotion intensity (such as RNR2, ADH1, GAPDH, TEF1, PGK1 and SED1) and coding sequences of proteins of RNAP (suchas T7RNAP, T3RNAP, T4RNAP and T5RNAP), if the nucleic acid construct of the invention is applied into a yeast extracorporeal protein synthesis system, the activity of synthesized luciferase is quite high relative to light unit value (RLU), and the effect can be the same as the effect of T7RNAP added exogenously. The effect can reach up to 6.6* 107.

Description

technical field [0001] The present invention relates to the field of biotechnology, and preferably relates to a nucleic acid construct endogenously expressing RNA polymerase in cells. Background technique [0002] RNA polymerase is an RNA polymerase (RNA polymerase): an enzyme that uses a DNA strand or RNA as a template to catalyze the synthesis of RNA from nucleoside-5'-triphosphate. The enzyme that synthesizes RNA that uses nucleoside as a substrate and polymerizes through phosphodiester bonds is also called transcriptase because it is related to the transcription of the genetic information of gene DNA into RNA in the cell. [0003] T7 RNA polymerase (T7 RNAP) is an RNA polymerase derived from T7 bacteriophage, which recognizes a 23 nt conserved promoter sequence (pT7) and provides strong transcriptional activity. T7 RNAP is widely used in Escherichia coli ( Escherichia coli ) and other foreign gene expression in prokaryotes have also been successfully applied in eukar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N1/19C12R1/645
CPCC12N9/1247C12N15/815C12Y207/07006C12N15/81C12R2001/645C12N1/145
Inventor郭敏代田纯薛银鸽李海洋王海鹏柴智刘帅龙于雪
OwnerKANGMA SHANGHAI BIOTECH LTD