A molecular detection method for red meat traits formed by the accumulation of anthocyanins in citrus
A molecular detection and anthocyanin technology, applied in the field of agricultural biology, can solve problems such as difficulty in identifying bud changes with minimal genetic differences, and achieve the effects of low cost, high-throughput analysis, and easy popularization and application.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] "Navel blood orange" (the red meat character formed by the accumulation of anthocyanins), "late red blood orange" (the red meat character formed by the accumulation of anthocyanins), "21st century navel orange" (the common yellow flesh character) and "21st century navel orange" were extracted respectively. Caracalla red-fleshed navel orange (red flesh character formed by the accumulation of lycopene) juice, use a spectrophotometer to measure the absorbance values (at 510nm wavelength) of the juice of the sample to be tested in two buffer solutions, and then calculate the juice. total anthocyanin content. The result is as figure 1 As shown, the red meat traits of pulp were positively correlated with the content of anthocyanins. The relative transcription amount of Cs6g17570 in pulp was detected by fluorescence quantitative PCR. The result is as figure 1 As shown, the transcript level of Cs6g17570 was higher in pulp with higher anthocyanin content.
Embodiment 2
[0042] "Late red blood orange" was selected to study the changes of Cs6g17570 transcript in pulp with fruit development.
[0043] As the fruit developed and matured, the anthocyanin content in the pulp and the transcription of Cs6g17570 were measured, respectively. The results showed that with the development and maturity of "late red blood orange" fruit, the transcription level of Cs6g17570 in its pulp was significantly positively correlated with the change of anthocyanin content in juice (γ=0.798, P=0.01).
[0044] The present inventors investigated the insertion of retrotransposons into Cs6g17570 and its upstream regulatory sequences. like image 3 As shown, the following primers were designed according to the gene structure, and the red meat traits of the samples to be tested were detected by PCR amplification.
[0045] Fannie-F: tgcttcacccaccaatttcctaaca SEQ ID NO.2
[0046] Cici-R: tacgaactcctaaggaatccgccat SEQ ID NO.3
Embodiment 3
[0048] DNA extraction
[0049] Weigh 50-100 mg of leaves of different varieties, grind them into powder in liquid nitrogen, and transfer them to a 2 ml centrifuge tube. Add 500 μL of Buffer CP1 and 6 μL of 2-mercaptoethanol, and vortex for 30 s. Add 5 μL of RNAse to a 1.65°C water bath for 15 minutes, and mix by inversion every 3 minutes. Prepare a chloroform-isoamyl alcohol mixture (chloroform:isoamyl alcohol=24:1), add 800 μL of the mixture, vortex for 30 s, centrifuge, 10000 g, 10 min. Take a new 1.5ml centrifuge tube and transfer 300μL of supernatant to the centrifuge tube. Add 150 μL of Buffer CP2 and 300 μL of absolute ethanol, and mix by inverting several times. Add it to the adsorption column (with collection tube) in two times, centrifuge, 10000g, 1min. Change to a new collection tube, add 650 μL wash Buffer, centrifuge at 10,000 g for 1 min, repeat three times. Replace the collection tube with a new one, and empty it once, 14000g, 2min. Add 50-100 μL of Elution...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More