Identification and application of SNP in fourth exon region of INCENP of pigs

A technology for boars and traits, applied in the field of identification and application of molecular markers for reproductive traits of boars

Active Publication Date: 2019-03-29
HUAZHONG AGRI UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report on the SNP in the boar INCENP exon region

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification and application of SNP in fourth exon region of INCENP of pigs
  • Identification and application of SNP in fourth exon region of INCENP of pigs
  • Identification and application of SNP in fourth exon region of INCENP of pigs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 Extraction of Boar Semen Genomic DNA Using Phenol Extraction

[0022] Inject the fresh semen of the boar collected on the spot (from the Yaji Mountain Pig Artificial Insemination Center of Guangxi Yangxiang Pig Gene Technology Co., Ltd., the American Duroc, Landrace and Large White breeds, the same below) into 10ml centrifuge tubes and stored frozen at -20°C. Transported to the laboratory below 0°C, then thawed in a water bath, and extracted boar semen genomic DNA. Specific steps are as follows:

[0023] (1) Take 1ml of pig semen, put it in a 2ml centrifuge tube, centrifuge at 5000rpm for 7min, discard the supernatant.

[0024] (2) Add 1000ul sperm washing solution (1M Tris-Hcl (PH=8.0) 10ml, 0.5M EDTA (PH=8.0) 20ml, 5M NaCl 100ml to each centrifuge tube, add ddH 2 (870ml, mix well, conventional high-pressure steam sterilization, store at room temperature) or normal saline, blow and beat repeatedly, centrifuge at 12000rpm for 7min, and discard the supernata...

Embodiment 2

[0033] Embodiment 2: the acquisition of boar INCENP fourth exon region-specific DNA fragment and the establishment of single nucleotide polymorphism (SNP) detection method

[0034] Select pigs of foreign blood, such as American "Duroc", "Landrace", and "Large White" (from the Yaji Mountain Pig Artificial Insemination Center, a subsidiary of Guangxi Yangxiang Pig Gene Technology Co., Ltd., which are routinely reported American breeds , the implementation of the present invention is not limited to the above-mentioned varieties) take the mRNA sequence of pig INCENP gene (GeneBank accession number is NC_010444) as seed, compare in the genome of pig, design following primers according to its fourth exon sequence:

[0035] Forward primer F: 5'CTCCGCAGCAAGGACAAGG 3',

[0036] Reverse primer R: 5'AGGCACAAAGGACCACCCAC 3';

[0037] Taking Duroc pig, Landrace pig, and Large White pig blood genome DNA as templates respectively, carry out PCR amplification with the above-mentioned primer ...

Embodiment 3

[0047] Example 3: Association analysis and application of molecular markers cloned in the present invention and reproductive traits of boars

[0048] Statistics of Genotype Frequency and Allele Frequency

[0049] Genotype frequency: refers to the proportion of a specific genotype in a population to all genotypes in the population. The statistical method of genotype frequency is: genotype frequency = number of individuals of this genotype / total number of measured populations

[0050] Allele frequency: refers to the relative proportion of a gene in a population to the total genes at that locus. Statistical method of allele frequency: genotype frequency of homozygote of this gene + genotype frequency of heterozygote containing this gene / 2

[0051] Table 3 The genotype frequency and allele frequency of the SNP in the fourth exon region of INCENP in two breeds of pigs

[0052]

[0053] In order to determine whether the SNP in the fourth exon region of the pig INCENP gene is r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of preparation of molecular markers of pigs, and particularly relates to identification and application of SNP in fourth exon region of INCENP of pigs. An SNP molecular marker associated with the propagation property of boars is obtained, the nucleotide sequence of the SNP molecular marker is as shown in SEQID NO:1, or SEQID NO:2 or SEQID NO:3, C / T mutation, C / Tmutation and T / C mutation respectively exist at 327bp of the sequences as shown in the SEQID NO:1, the SEQID NO:2 and the SEQID NO:3, and the mutation of alleles cause polymorphism of Tsp45I-RFLP. Through the molecular marker, the analysis associated with the propagation property of the boars is performed in landrace and large white pigs. The invention also discloses a typing detection method of the molecular marker. A new marker is provided for the propagation property of the boars, and the molecular marker can be used for evaluating and detecting the propagation property of the boars and heredity improvement.

Description

technical field [0001] The invention relates to the fields of pig breeding and molecular marker-assisted selection of pigs, in particular to the identification and application of SNP in the exon region of pig INCENP as a molecular marker for reproductive traits of boars. Background technique [0002] Molecular marker-assisted selection (MAS, marker-assisted selection) is a new technology produced with the rapid development of modern molecular biology technology, which can quickly and accurately analyze the genetic composition of individuals at the molecular level, so as to realize the genotype Direct selection, molecular breeding. Molecular markers are directly expressed in the form of DNA, which can be detected in all tissues and developmental stages of organisms, and are not restricted by seasonal environments; polymorphisms are abundant and large in number; most of them are co-dominant, and can distinguish homozygous and heterozygous fit. Therefore, molecular marker-ass...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor徐德全张龙刘敏夏文周昌繁
OwnerHUAZHONG AGRI UNIV