Unlock instant, AI-driven research and patent intelligence for your innovation.
Safflower ctaco3 gene, its encoded protein and its application
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A safflower and gene technology, applied in the field of genetic engineering, can solve problems such as unclear influence and achieve the effect of increasing the content
Active Publication Date: 2022-02-11
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF4 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, the effect of ACO on flavonoid accumulation or flavonoid metabolic pathways remains unclear
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
[0052]With saffron 5 'and 3'race cDNA library as template, using GSP primers for universal primer UPM (Universal Primeramix) and design, PCR amplification, 5' port sequences of CTACO3 and 3 'sequences, to get 1143 bp 5' - Conservative fragments and 955 bp 3'-conservative fragments with Polya tails.
[0053] The 5 'and 3'-cDNA fragment sequences obtained by sequencing CTACO3 sequences are sequence splicing on Vector NTI Suite 9.0 to obtain a full length sequence of cDNA.
[0054] The PCR primer of the full-length cDNA was expanded based on the CDNA end design of this sequence (AataAcagagaagtatgtcattagggt, SEQ ...
Embodiment 2
[0057] Example 2. CTACO3 pollen tube channel method transformed red flower plant
[0058] In order to further analyze the function of CTACO3, we transferred it to the saffron through the pollen tube channel method, and after observing the expression of CTACO3, other genes and flavonoid metabolites were observed.
[0059] First, carrier construction
[0060] The ORF zone seamless cloned primer was designed, the amplification primer was SEQ ID No.4 (gagctttcgcccgccccatgggggcccccccccatgggggccacactgat) and SEQ ID NO.5 (Atttaattacctggggctttcagcgggcaatggggg), and constructs the eukaryotic expression vector PMT39, and the amplification product is connected to the carrier, A recombinant vector containing the purpose gene is produced.
[0063] A. Cultivating safflower plants in the greenhouse, temperature 25 ° C, circadian rhythm is 16 hours of light / 8 hours dark.
[0064] B. Turn the contro...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention relates to the field of genetic engineering, in particular to the application of the safflower CtACO3 gene and its encoded protein in increasing the content of flavonoids in the safflower. The invention provides for the first time that safflower CtACO3 participates in the regulation of genes related to safflower flavonoidbiosynthesis pathway, and CtACO3 is transferred into safflower by a transgenic method, which can increase the content of quinone chalcones.
Description
Technical field [0001] The present invention relates to the field of genetic engineering. Background technique [0002] Traditional Chinese medicine saffron (Carthami Flos) has the effect of promoting blood circulation, passing through the active ingredient, which is flavonoid compound, hydroxy safflower yellow-parallel A (HSYA), Carthamin, quercetin and its galaxy, sarcol And its gaosine is considered to be a major active ingredient for pharmacological activity. Therefore, the regulation of key genes by safflower flavonoid metabolic channel is an effective method for increasing the flavonoid content of safflower. [0003] Fraxtone ingredients are important secondary metabolites of plants, and are widely affected by the external environment and stimulus. As a gaseous planthormone, ethylene regulates various processes of plant growth, development and stress reactions, and as signal molecules that conduct external stimulus. Studies have shown that exogenous applications of ethylen...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More