Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

General RPA primer, RPA probe, kit and nucleic acid detection method for detecting dog, cat and mink parvoviruses

A parvovirus and kit technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of no parvovirus detection, and achieve convenient application and promotion, broad market prospects, and major clinical The effect of applying value

Inactive Publication Date: 2019-04-19
SHENYANG AGRI UNIV
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] At present, RPA technology and lateral flow chromatography technology have not been used to detect canine, cat and mink parvovirus at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • General RPA primer, RPA probe, kit and nucleic acid detection method for detecting dog, cat and mink parvoviruses
  • General RPA primer, RPA probe, kit and nucleic acid detection method for detecting dog, cat and mink parvoviruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] A general RPA primer and RPA probe for detecting dog, cat, mink parvovirus, characterized in that, the RPA primer includes a forward primer PVRPAF, its sequence is: CCATCTCATACTGGAACTAGTGGCACACCAAC,

[0027] The reverse primer is PVRPAB, its sequence is:

[0028] Bio-CTCAAAAGAATATATGGTGCACTATAACCAAC,

[0029] Wherein the RPA probe designed based on the RPA primer amplification region is PVRPAP, and its sequence is:

[0030] FAM-CTCCTTCAGCTTGAGGCAAAGAATTTAGAAATGGTGGHAAGCCCAATGCTC-C3spacer.

[0031]The present invention also provides an RPA kit for detecting parvoviruses in dogs, cats and mink, which includes the above-mentioned RPA primers and RPA probes, and specifically, also includes: (1) sample treatment solution: 0.2M KOH solution; (2) Detection reaction solution: 50 mM Tris-HCl pH7.9; 100 mM potassium acetate; 2 mM dithiothreitol; 3 mM adenosine triphosphate; 20 mM creatine phosphate; 5 μg creatine kinase; Polyethylene glycol with 5% mass fraction, 200 μM deoxyr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a general RPA primer, an RPA probe, a kit and a nucleic acid detection method for detecting dog, cat and mink parvoviruses. The RPA primer comprises a forward primer PVRPAF anda reverse primer PVRPAB, wherein the sequence of the forward primer is CCATCTCATACTGGAACTAGTGGCACACCAAC, and the sequence of the reverse primer is Bio-CTCAAAA GAATAATATGGTGGCACTATAACCAC. The RPA probe designed based on an RPA primer amplification region is PVRPAP, and the sequence of the RPA probe is FAM-CTCCTTCAGCTTGAGGCAAAGAATTTAGAAATGGTGGHAAGCCCAATGCTC-C3s pacer. According to the invention, simple sample treatment and recombinase amplification techniques and a lateral flow chromatography technique are combined, the detection can be carried out without any equipment in an attack site, a detection result can be obtained within one hour, treatment can be carried out by taking measures in the first time, and the primer is very suitable for field use.

Description

technical field [0001] The invention belongs to the field of virus detection biotechnology, and in particular relates to a general RPA primer, RPA probe, kit and nucleic acid detection method for detecting dog, cat and mink parvoviruses. Background technique [0002] Canine, feline, and mink parvoviruses can cause severe viral diarrhea in the corresponding hosts, which are highly lethal and contagious. [0003] Feline panleukopenia caused by feline parvovirus (FPV) is characterized by high fever, vomiting, severe leukopenia, and enteritis. Under natural conditions, it infects a variety of cats and mustelids, such as tigers, leopards, lions and raccoons, but smaller cats, including minks, are most susceptible. FPV is currently the virus with the widest infection range and the strongest pathogenicity. It is therefore one of the main viruses in this genus. Feline panleukopenia is a highly contagious infectious disease that mainly affects young cats. The incubation period is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/701C12Q2600/166C12Q2531/119C12Q2565/625C12Q2545/113C12Q2521/507C12Q2522/101C12Q2537/1376
Inventor 刘宝山姚龙泉张文奎吴长德
Owner SHENYANG AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com