Primer, probe and kit for detecting clonorchis sinensis through RAA fluorescence method
A technology of Clonorchis sinensis and fluorescence method, which is applied in the field of primer probes and kits for detection of Clonorchis sinensis by RAA fluorescence method, can solve the problems of high target gene requirements and high false positive rate, and achieve high throughput, The effect of high sensitivity and short detection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 A primer, probe and kit for rapid detection of Clonorchis sinensis based on RAA fluorescence method
[0036](1) According to the gene name Clonorchis sinensis (Clonorchis sinensis), find the corresponding full gene sequence in the genebank (www.ncbi.nlm.nih.gov), use DNAMAN software for homology analysis, and screen out the Clonorchis sinensis The highly conserved sequence of trematodes is as follows: TCATTACAGTACACAAAAGCCCAAACACCTCAGTTAATCTGAGCATTTGGCACGGGTCGTCATGCCCGTTGTTCTTGCAGCCTTGCCTGCCTAGGGCGGAGCGATTCTAGTTCCGTCATNTGTCTTGCAGCATTGTCTGCCTAGGGCGGAGCGATCCTAGTTCCGTCATGTTCTACATGTATGTTCCGCATGCATGCTGCAGCGTTGTCTGTCTAG.
[0037] (2) Using the highly conserved sequence as the target gene for detection, synthesize a positive plasmid with a size of 223bp.
[0038] (3) Design primers and probes according to the conserved sequence of Clonorchis sinensis, design 3 pairs of primers, design 3 upstream and downstream respectively, and design a probe in the interval included...
Embodiment 2
[0067] Embodiment 2 Sensitivity experiment
[0068] Upstream primers:
[0069] 5'-TCATTACAGTACACAAAAGCCCAAACACCTCAG-3'; SEQ ID NO.1;
[0070] Downstream primers:
[0071] 5'-GCTCCACCGTAGGCAGACAACGCTGCAGCATG-3'; SEQ ID NO.2.
[0072] The probe sequence is:
[0073] 5'-CGTCATGCCCGTTGTTCTTGCAGCCTTGCCTGCCTAGGGCGGAGCGATTCT-3'; SEQ ID NO.3;
[0074] The probe is modified with a fluorescent reporter group (FAM) and a fluorescent quencher group (BHQ1);
[0075] The modified probe is:
[0076] CGTCATGCCCGTTGTTCTTGCAGCCTTGCC(BHQ1-dT)G(THF)C(FAM-dT)AGGGCGGAGCGATTCT.
[0077] The composition of the kit is shown in Table 1:
[0078] Table 1 Kit composition list
[0079]
[0080] The prepared recombinant plasmid working standards are:
[0081] Working Standard 1, containing 1.0 × 10 7 Copies / μL Clonorchis sinensis plasmid non-infectious DNA fragment.
[0082] Working Standard 2, containing 1.0 × 10 6 Copies / μL Clonorchis sinensis plasmid non-infectious DNA fragment.
[0083]...
Embodiment 3
[0096] Embodiment 3 repeatability experiment
[0097] Primer probe and positive quality control product sequence are identical with embodiment 2.
[0098] The composition of the kit is shown in Table 2:
[0099] Table 2 Kit composition list
[0100]
[0101]
[0102] (1) Reaction buffer preparation:
[0103] Draw 176.8 μL of reaction buffer solution from the reaction buffer tube in the kit and add it to the pre-prepared 1.5mL EP tube, then add 19.2 μL of the mixture of probe and primer (the concentration of the probe is 0.02mM, and the concentration of the primer is 0.1mM ), fully mixed to obtain the mixed reaction buffer;
[0104] (2) RAA fluorescent basic reaction reagent redissolved
[0105] Prepare 4 RAA fluorescent basic reaction reagents, draw 46.5 μL of the reaction buffer mixed in step 1 each time, and add them to the prepared 4 RAA fluorescent basic reaction reagent tubes, so that the lyophilized powder is fully dissolved and mixed to become RAA reaction sy...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


