Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, probe and kit for detecting clonorchis sinensis through RAA fluorescence method

A technology of Clonorchis sinensis and fluorescence method, which is applied in the field of primer probes and kits for detection of Clonorchis sinensis by RAA fluorescence method, can solve the problems of high target gene requirements and high false positive rate, and achieve high throughput, The effect of high sensitivity and short detection time

Inactive Publication Date: 2019-04-30
JIANGSU INST OF PARASITIC DISEASES +1
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The LAMP method in the isothermal nucleic acid technology overcomes the disadvantages of PCR technology that requires expensive equipment and instruments, and has the advantages of simple operation and simple result judgment. It has been used for the detection of Clonorchis sinensis. Gene requirements are high, and the false positive rate is relatively high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe and kit for detecting clonorchis sinensis through RAA fluorescence method
  • Primer, probe and kit for detecting clonorchis sinensis through RAA fluorescence method
  • Primer, probe and kit for detecting clonorchis sinensis through RAA fluorescence method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 A primer, probe and kit for rapid detection of Clonorchis sinensis based on RAA fluorescence method

[0036](1) According to the gene name Clonorchis sinensis (Clonorchis sinensis), find the corresponding full gene sequence in the genebank (www.ncbi.nlm.nih.gov), use DNAMAN software for homology analysis, and screen out the Clonorchis sinensis The highly conserved sequence of trematodes is as follows: TCATTACAGTACACAAAAGCCCAAACACCTCAGTTAATCTGAGCATTTGGCACGGGTCGTCATGCCCGTTGTTCTTGCAGCCTTGCCTGCCTAGGGCGGAGCGATTCTAGTTCCGTCATNTGTCTTGCAGCATTGTCTGCCTAGGGCGGAGCGATCCTAGTTCCGTCATGTTCTACATGTATGTTCCGCATGCATGCTGCAGCGTTGTCTGTCTAG.

[0037] (2) Using the highly conserved sequence as the target gene for detection, synthesize a positive plasmid with a size of 223bp.

[0038] (3) Design primers and probes according to the conserved sequence of Clonorchis sinensis, design 3 pairs of primers, design 3 upstream and downstream respectively, and design a probe in the interval included...

Embodiment 2

[0067] Embodiment 2 Sensitivity experiment

[0068] Upstream primers:

[0069] 5'-TCATTACAGTACACAAAAGCCCAAACACCTCAG-3'; SEQ ID NO.1;

[0070] Downstream primers:

[0071] 5'-GCTCCACCGTAGGCAGACAACGCTGCAGCATG-3'; SEQ ID NO.2.

[0072] The probe sequence is:

[0073] 5'-CGTCATGCCCGTTGTTCTTGCAGCCTTGCCTGCCTAGGGCGGAGCGATTCT-3'; SEQ ID NO.3;

[0074] The probe is modified with a fluorescent reporter group (FAM) and a fluorescent quencher group (BHQ1);

[0075] The modified probe is:

[0076] CGTCATGCCCGTTGTTCTTGCAGCCTTGCC(BHQ1-dT)G(THF)C(FAM-dT)AGGGCGGAGCGATTCT.

[0077] The composition of the kit is shown in Table 1:

[0078] Table 1 Kit composition list

[0079]

[0080] The prepared recombinant plasmid working standards are:

[0081] Working Standard 1, containing 1.0 × 10 7 Copies / μL Clonorchis sinensis plasmid non-infectious DNA fragment.

[0082] Working Standard 2, containing 1.0 × 10 6 Copies / μL Clonorchis sinensis plasmid non-infectious DNA fragment.

[0083]...

Embodiment 3

[0096] Embodiment 3 repeatability experiment

[0097] Primer probe and positive quality control product sequence are identical with embodiment 2.

[0098] The composition of the kit is shown in Table 2:

[0099] Table 2 Kit composition list

[0100]

[0101]

[0102] (1) Reaction buffer preparation:

[0103] Draw 176.8 μL of reaction buffer solution from the reaction buffer tube in the kit and add it to the pre-prepared 1.5mL EP tube, then add 19.2 μL of the mixture of probe and primer (the concentration of the probe is 0.02mM, and the concentration of the primer is 0.1mM ), fully mixed to obtain the mixed reaction buffer;

[0104] (2) RAA fluorescent basic reaction reagent redissolved

[0105] Prepare 4 RAA fluorescent basic reaction reagents, draw 46.5 μL of the reaction buffer mixed in step 1 each time, and add them to the prepared 4 RAA fluorescent basic reaction reagent tubes, so that the lyophilized powder is fully dissolved and mixed to become RAA reaction sy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, a probe and a kit for detecting clonorchis sinensis through a RAA fluorescence method. The kit comprises the primer, the probe, a RAA fluorescence universal reactant,a reaction buffer solution, a negative quality control substance, and a positive quality control substance. The kit carries out isothermal amplification detection at a temperature of 30 to 42 DEG C,the detection is finished within 5 to 20 minutes; the operation is simple, and the kit can be co-used with a small instrument, is portable, has the characteristics of rapidness, sensitivity, accuracy,and good repeatability, is suitable for basic detection and on-site detection, and has a good application prospect.

Description

technical field [0001] The invention relates to the technical field of molecular biology detection, in particular to a primer probe and a kit for detecting Clonorchis sinensis by RAA fluorescence method. Background technique [0002] Clonorchiasis (Clonorchiasis) is a food-borne zoonotic parasitic disease caused by infection with Clonorchis sinensis (Cs), which seriously endangers human health. The disease is mainly distributed in North Korea, South Korea, northern Vietnam, a small part of Russia and most of China. According to statistics, about 35 million people in the world are infected with this parasite, and 15 million of them are distributed in our country. In my country, except Tibet, Qinghai, Ningxia, Inner Mongolia, etc. have not been reported, the remaining 27 provinces, municipalities and autonomous regions have Different degrees of prevalence, of which Guangdong, Guangxi, Jilin, Liaoning, and Heilongjiang are heavily endemic areas. [0003] Clonorchis sinensis, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/6888C12Q2521/507C12Q2531/119C12Q2563/107C12Q2545/113
Inventor 戴洋倪碧娴曹俊刘燕红郭利川王智宏应清界
Owner JIANGSU INST OF PARASITIC DISEASES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com