Check patentability & draft patents in minutes with Patsnap Eureka AI!

Interaction factor gene Actin for zinc finger binding protein of corn, and recombinant expression vector and application thereof

A technology for binding protein and zinc finger protein, which can be used in application, genetic engineering, plant genetic improvement, etc., and can solve the problems of low AOS content, instability, difficulty in content determination and tissue localization, etc.

Active Publication Date: 2019-06-21
UNIV OF JINAN
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

AOS is currently a hot spot in the research on plant disease resistance. However, due to the small and unstable content of AOS, it is difficult to determine the content and locate the tissue. Different tissue parts often require different methods for detection, and there are few domestic AOS detection methods. research report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Interaction factor gene Actin for zinc finger binding protein of corn, and recombinant expression vector and application thereof
  • Interaction factor gene Actin for zinc finger binding protein of corn, and recombinant expression vector and application thereof
  • Interaction factor gene Actin for zinc finger binding protein of corn, and recombinant expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Yeast double hybrid:

[0020] 1. Yeast recombinant vector construction

[0021] The full-length genes of zinc finger protein gene (GRMZM2G035341) and Actin gene (GRMZM2G152328) were designed to introduce primers into the KpnI restriction site at the start site (ATG) of the gene, and a PacI restriction site was introduced at the 3' end, respectively. The PCR method amplifies the full-length cDNA of the gene, and the primer sequence used for gene amplification is:

[0022] 2328-F KpnI: CGGGGTACCATGGCCGATGCCGAGGATAT

[0023] 2328-R PacI; CCTTAATTAACGATGGATGGGCCGGACTCG

[0024] 5341-F KpnI: CGGGGTACCATGTCCGCCATGGAGACCGA

[0025] 5341-R PacI: CCTTAATTAACTAGTGGCCATATTTCTGGAACT The obtained amplified product was recovered by gel, and its concentration was determined. The vector and the target gene must use the same enzyme cutting site, and then use KpnI and PacI to double-cut the target gene fragment and vector, and then recover it again. Use NEB's T4 ligase to...

Embodiment 2

[0058] Example 2 Bimolecular Fluorescence Complementation (BiFC):

[0059] 1. vector construction

[0060] (1) Construction of the carrier

[0061] 1) The method used to construct the vector is homologous recombination. The homologous recombination enzyme was purchased from Quanshijin Biotech Co., Ltd., and the primers for the full-length gene homologous sequences of the zinc finger protein gene (GRMZM2G035341) and the Actin gene (GRMZM2G152328) were designed as follows:

[0062] BP-5341-F: GGGGACAACTTTGTACAAAAAAGTTGGCATGTCCGCCATGGAGACCGACA

[0063] BP-5341-R: GGGGACAACTTTGTACAAGAAAGTTGGGCAGTGGCCATATTTCTGGAACTC

[0064] BP-2328-F: GGGGACAACTTTGTACAAAAAAGTTGGCATGGCCGATGCCGAGGATAT

[0065] BP-2328-R: GGGGACAACTTTGTACAAGAAAGTTGGGCATGGGCCGGACTCGAGGTCA

[0066] 2) Using the plasmids extracted from the T vectors of Escherichia coli zinc finger protein gene (GRMZM2G035341) and Actin gene (GRMZM2G152328) as templates, use the above primers to amplify the target gene sequence, rec...

Embodiment 3

[0150] The mensuration of embodiment 3 active oxygen

[0151] Cytochrome C method

[0152] Cytochrome C was first used to detect O in animal cells 2- , the detection method is based on O 2- Oxidized cytochrome C can be reduced to reduced cytochrome C, which has a maximum light absorption at 550nm. Inject the bacterial solution containing the recombinant vector into the tobacco leaves after growing for three days, then immerse in the phosphate buffer (pH7.8) containing 20 μmol / L cytochrome C, take a sample every 2 minutes, measure the OD550 of the reaction solution, within 10 minutes The increase of OD550 is linear, from which the O2- content can be calculated. Cytochrome C is a protein with a molecular weight of 12.5kD. The movement of such macromolecular substrates and the ability to penetrate plant walls will be limited, so cytochrome C can also be used for O 2- Make a positioning determination. pass Figure 4 It was found that the content of reactive oxygen species in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of biotechnology, and particularly relates to an interaction factor gene Actin for zinc finger binding protein of corn, and a recombinant expression vector and application thereof. The full length of the gene is 12712 bp, and the gene is a complete expression frame. The gene comprises 6 exons and is encoded with 123 amino acids. Through expression detection in yeast, it is found that a Zm-Actin gene and a Zm-ZnRing gene can have obviously mutual regulation effect and play a role in chloroplasts through co-localization. The gene Actin has a function of improving the translation efficiency of foreign genes, the zinc finger binding protein has the activity of E3 ubiquitin ligase, the E3 ubiquitin ligase involves in a salt stress response process of plants, and the growth and metabolism of cells are regulated through control of membrane transport and generation of reactive oxygen; the gene can be applied to increase the reactive oxygen in tobacco leaves so as to regulate the growth and metabolism of the cells.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the gene Actin, a maize zinc finger binding protein interaction factor gene, and its recombinant expression vector and application. Background technique [0002] The E3 ubiquitination ligase that catalyzes the terminal process in the protein ubiquitination pathway of many RING-type zinc finger proteins contains a RING domain. These RING-type zinc finger proteins mainly participate in the ubiquitination through the interaction with other proteins Degradation of over-ubiquitinated proteins will change protein activity and affect biological effects. RING-type zinc finger proteins may be involved in many important biological effects. RING-type zinc finger protein genes are also closely related to salt stress. Zinc finger binding protein also has E3 ubiquitin ligase activity, participates in the process of plant salt stress response, mainly regulates the expression of genes r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N5/10A01H5/00A01H6/82
Inventor 李慧何林林朱建堂裴腊明高幸幸
Owner UNIV OF JINAN
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More