Interaction factor gene Actin for zinc finger binding protein of corn, and recombinant expression vector and application thereof
A technology for binding protein and zinc finger protein, which can be used in application, genetic engineering, plant genetic improvement, etc., and can solve the problems of low AOS content, instability, difficulty in content determination and tissue localization, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 Yeast double hybrid:
[0020] 1. Yeast recombinant vector construction
[0021] The full-length genes of zinc finger protein gene (GRMZM2G035341) and Actin gene (GRMZM2G152328) were designed to introduce primers into the KpnI restriction site at the start site (ATG) of the gene, and a PacI restriction site was introduced at the 3' end, respectively. The PCR method amplifies the full-length cDNA of the gene, and the primer sequence used for gene amplification is:
[0022] 2328-F KpnI: CGGGGTACCATGGCCGATGCCGAGGATAT
[0023] 2328-R PacI; CCTTAATTAACGATGGATGGGCCGGACTCG
[0024] 5341-F KpnI: CGGGGTACCATGTCCGCCATGGAGACCGA
[0025] 5341-R PacI: CCTTAATTAACTAGTGGCCATATTTCTGGAACT The obtained amplified product was recovered by gel, and its concentration was determined. The vector and the target gene must use the same enzyme cutting site, and then use KpnI and PacI to double-cut the target gene fragment and vector, and then recover it again. Use NEB's T4 ligase to...
Embodiment 2
[0058] Example 2 Bimolecular Fluorescence Complementation (BiFC):
[0059] 1. vector construction
[0060] (1) Construction of the carrier
[0061] 1) The method used to construct the vector is homologous recombination. The homologous recombination enzyme was purchased from Quanshijin Biotech Co., Ltd., and the primers for the full-length gene homologous sequences of the zinc finger protein gene (GRMZM2G035341) and the Actin gene (GRMZM2G152328) were designed as follows:
[0062] BP-5341-F: GGGGACAACTTTGTACAAAAAAGTTGGCATGTCCGCCATGGAGACCGACA
[0063] BP-5341-R: GGGGACAACTTTGTACAAGAAAGTTGGGCAGTGGCCATATTTCTGGAACTC
[0064] BP-2328-F: GGGGACAACTTTGTACAAAAAAGTTGGCATGGCCGATGCCGAGGATAT
[0065] BP-2328-R: GGGGACAACTTTGTACAAGAAAGTTGGGCATGGGCCGGACTCGAGGTCA
[0066] 2) Using the plasmids extracted from the T vectors of Escherichia coli zinc finger protein gene (GRMZM2G035341) and Actin gene (GRMZM2G152328) as templates, use the above primers to amplify the target gene sequence, rec...
Embodiment 3
[0150] The mensuration of embodiment 3 active oxygen
[0151] Cytochrome C method
[0152] Cytochrome C was first used to detect O in animal cells 2- , the detection method is based on O 2- Oxidized cytochrome C can be reduced to reduced cytochrome C, which has a maximum light absorption at 550nm. Inject the bacterial solution containing the recombinant vector into the tobacco leaves after growing for three days, then immerse in the phosphate buffer (pH7.8) containing 20 μmol / L cytochrome C, take a sample every 2 minutes, measure the OD550 of the reaction solution, within 10 minutes The increase of OD550 is linear, from which the O2- content can be calculated. Cytochrome C is a protein with a molecular weight of 12.5kD. The movement of such macromolecular substrates and the ability to penetrate plant walls will be limited, so cytochrome C can also be used for O 2- Make a positioning determination. pass Figure 4 It was found that the content of reactive oxygen species in...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



