Unlock instant, AI-driven research and patent intelligence for your innovation.

Maize zinc finger binding protein interaction factor gene actin and its recombinant expression vector and application

A technology of protein interaction and protein binding, applied in the field of corn zinc finger binding protein interaction factor gene Actin and its recombinant expression vector, can solve the problems of low AOS content, instability, difficulty in content determination and tissue positioning, etc., and achieve improved Translation efficiency, the effect of increasing the active oxygen

Active Publication Date: 2022-03-18
UNIV OF JINAN
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

AOS is currently a hot spot in the research on plant disease resistance. However, due to the small and unstable content of AOS, it is difficult to determine the content and locate the tissue. Different tissue parts often require different methods for detection, and there are few domestic AOS detection methods. research report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Maize zinc finger binding protein interaction factor gene actin and its recombinant expression vector and application
  • Maize zinc finger binding protein interaction factor gene actin and its recombinant expression vector and application
  • Maize zinc finger binding protein interaction factor gene actin and its recombinant expression vector and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Yeast double hybrid:

[0020] 1. Yeast recombinant vector construction

[0021] The full-length genes of zinc finger protein gene (GRMZM2G035341) and Actin gene (GRMZM2G152328) were designed to introduce primers into the KpnI restriction site at the start site (ATG) of the gene, and a PacI restriction site was introduced at the 3' end, respectively. The PCR method amplifies the full-length cDNA of the gene, and the primer sequence used for gene amplification is:

[0022] 2328-F KpnI: CGGGGTACCATGGCCGATGCCGAGGATAT

[0023] 2328-R PacI; CCTTAATTAACGATGGATGGGCCGGACTCG

[0024] 5341-F KpnI: CGGGGTACCATGTCCGCCATGGAGACCGA

[0025] 5341-R PacI: CCTTAATTAACTAGTGGCCATATTTCTGGAACT The obtained amplified product was recovered by gel, and its concentration was determined. The vector and the target gene must use the same enzyme cutting site, and then use KpnI and PacI to double-cut the target gene fragment and vector, and then recover it again. Use NEB's T4 ligase to...

Embodiment 2

[0058] Example 2 Bimolecular Fluorescence Complementation (BiFC):

[0059] 1. vector construction

[0060] (1) Construction of the carrier

[0061] 1) The method used to construct the vector is homologous recombination. The homologous recombination enzyme was purchased from Quanshijin Biotech Co., Ltd., and the primers for the full-length gene homologous sequences of the zinc finger protein gene (GRMZM2G035341) and the Actin gene (GRMZM2G152328) were designed as follows:

[0062] BP-5341-F: GGGGACAACTTTGTACAAAAAAGTTGGCATGTCCGCCATGGAGACCGACA

[0063] BP-5341-R: GGGGACAACTTTGTACAAGAAAGTTGGGCAGTGGCCATATTTCTGGAACTC

[0064] BP-2328-F: GGGGACAACTTTGTACAAAAAAGTTGGCATGGCCGATGCCGAGGATAT

[0065] BP-2328-R: GGGGACAACTTTGTACAAGAAAGTTGGGCATGGGCCGGACTCGAGGTCA

[0066] 2) Using the plasmids extracted from the T vectors of Escherichia coli zinc finger protein gene (GRMZM2G035341) and Actin gene (GRMZM2G152328) as templates, use the above primers to amplify the target gene sequence, rec...

Embodiment 3

[0150] The mensuration of embodiment 3 active oxygen

[0151] Cytochrome C method

[0152] Cytochrome C was first used to detect O in animal cells 2- , the detection method is based on O 2- Oxidized cytochrome C can be reduced to reduced cytochrome C, which has a maximum light absorption at 550nm. Inject the bacterial solution containing the recombinant vector into the tobacco leaves after growing for three days, then soak in the phosphate buffer (pH7.8) containing 20 μmol / L cytochrome C, take a sample every 2 minutes, measure the OD550 of the reaction solution, within 10 minutes The increase of OD550 is linear, from which the O2- content can be calculated. Cytochrome C is a protein with a molecular weight of 12.5kD. The movement of such macromolecular substrates and the ability to penetrate plant walls will be limited, so cytochrome C can also be used for O 2- Make a positioning determination. pass Figure 4 It was found that the content of reactive oxygen species in th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and in particular relates to the gene Actin, a maize zinc finger binding protein interaction factor gene, and its recombinant expression vector and application. The full length of the gene is 12712bp, which is a complete expression frame consisting of 6 exons and encoding 123 amino acids. Through expression detection in yeast, it was found that Zm‑Actin Genes can interact with Zm‑ ZnRing The genes have obvious mutual regulation, and the colocalization of the two genes plays a role in the chloroplast. The Actin gene disclosed in the present invention has the function of improving the translation efficiency of exogenous genes, and the zinc finger binding protein has E3 ubiquitin ligase activity, and the E3 ubiquitin ligase participates in the process of plant salt stress response, controls membrane transport and produces activity Oxygen is used to regulate cell growth and metabolism, and the gene can be applied to increase the increase of active oxygen in tobacco leaves to regulate cell growth and metabolism.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the gene Actin, a maize zinc finger binding protein interaction factor gene, and its recombinant expression vector and application. Background technique [0002] The E3 ubiquitination ligase that catalyzes the terminal process in the protein ubiquitination pathway of many RING-type zinc finger proteins contains a RING domain. These RING-type zinc finger proteins mainly participate in the ubiquitination through the interaction with other proteins Degradation of over-ubiquitinated proteins will change protein activity and affect biological effects. RING-type zinc finger proteins may be involved in many important biological effects. RING-type zinc finger protein genes are also closely related to salt stress. Zinc finger binding protein also has E3 ubiquitin ligase activity, participates in the process of plant salt stress response, mainly regulates the expression of genes r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N5/10A01H5/00A01H6/82
Inventor 李慧何林林朱建堂裴腊明高幸幸
Owner UNIV OF JINAN