Kit for detection of human PIK3CA gene mutation and clinical application

A kit and base sequence technology, applied in the field of genetic engineering, can solve the problems of non-luminescence of probes and inability of instruments to detect fluorescent signals, and achieve the effects of scale, low cost, and high sensitivity

Pending Publication Date: 2019-06-25
ZONHON BIOPHARMA INST
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The 5' end of the original probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group. When the probe is intact, the quencher group absorbs the fluorescent energy of the reporter group, the probe does not emit light, and the instrument cannot detect fluorescence. Signal

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detection of human PIK3CA gene mutation and clinical application
  • Kit for detection of human PIK3CA gene mutation and clinical application
  • Kit for detection of human PIK3CA gene mutation and clinical application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1PI

[0056] Embodiment 1 PIK3CA wild-type plasmid, mutant plasmid, internal control plasmid construction

[0057] The vector used for the construction of the PIK3CA mutant plasmid is Puc57, with a full length of 2710 bp, constructed by Nanjing GenScript Biotechnology Co., Ltd. The wild-type plasmid fragment 400bp (NM_006218.2), the mutant plasmid fragment 400bp (NM_006218.2), and the internal control plasmid fragment 400bp (NM_006218.2) (the conserved region was selected as the internal control) were respectively connected with the vector to synthesize the plasmid.

Embodiment 2

[0058] The design of embodiment 2 primers, probes

[0059] According to the mutation information, Primer Premier 5.0 software was used to design primers and probes. At the same time, primers and probes were designed on exon 1 of PIK3CA as internal and external controls: the sequences of internal and external controls were consistent, and the modified reporter fluorescent groups were different.

[0060] The primer length is about 19-30 bases, the GC content is 40-60%, the Tm value is 59-61°C, and the amplified fragment is about 150bp. The missense mutation site is located at the last position of the 3' end of the upstream primer, and at the same time, a mismatch mutation base is introduced at different positions of the upstream primer, and the mutant upstream primer that meets the requirements is selected after screening:

[0061] G1624A:

[0062] F1: AAGCAATTTCTACACGAGATCCTCTCTCTA

[0063] F2: AAGCAATTTCTACACGAGATCCTCTCTCCA

[0064] F3: AAGCAATTTCTACACGAGATCCTCTCTCGA

[00...

Embodiment 3

[0111] The preliminary screening of embodiment 3 primers, probes

[0112] Amplify the mutant plasmid, the wild-type plasmid, and the internal control plasmid for the primer probes respectively, and the combination of the mutant primer probes that meets the requirements is: amplifying the mutant plasmid, and having no amplification reaction with the wild-type and internal control plasmids.

[0113] Table 2 Primer probe primary screening PCR reaction system

[0114]

[0115] PCR reaction program: 50°C for 10min; 95°C for 5min; 40 cycles of 95°C for 15sec and 60°C for 1min, and collect fluorescence at 60°C.

[0116] Wherein: the internal control / external control amplification fragment is shown in SEQ ID NO: 1;

[0117] The wild-type amplified fragments of G1624A, G1633A, and G1635T are shown in SEQ ID NO: 2;

[0118] A3140G, A3140T wild-type amplified fragments are shown in SEQ ID NO: 3;

[0119] The G1624A mutant amplified fragment is shown in SEQ ID NO: 4;

[0120] The G...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a primer for detecting mutation of a human PIK3CA gene, a probe and a kit. The screened specific ARMS primer and the probe, and an optimized reaction system can obtain the kitfor detecting mutation of human PIK3CA gene with excellent detection performance. The detection of the kit is fast and detection can be completed in 90 minutes, the sensitivity is high, and the kit can detect PIK3CA gene mutation with the content as low as 1% in a 10ng DNA sample; the specificity is high, no amplification is generated with wild-type samples; the kit is easy to operate, has low cost, is conducive to large scale and marketization, and can be effectively applied to clinical precision guidance medication.

Description

technical field [0001] The invention relates to the field of genetic engineering, and more specifically, to a primer, a probe and a kit for detecting human PIK3CA gene mutation. Background technique [0002] The phosphatidylinositol-3-kinase catalytic subunit alpha (PIK3CA) gene is a 34 kb gene on chromosome 3, consisting of 20 exons, encoding the p110α catalytic subunit of class I phosphatidylinositol-3-kinase unit. The PIK3CA gene is an oncogene and the only gene that undergoes somatic mutations. The mutations of the PIK3CA gene include gene amplification, deletion, and somatic missense mutations. The PIK3CA gene is mutated in a variety of human tumors, resulting in abnormal regulation of the PI3K signaling pathway at different levels, and high-frequency somatic mutations have occurred in colorectal cancer, ovarian cancer, breast cancer, gastric cancer, liver cancer and other tumors. [0003] The mutation frequency of PIK3CA gene is lower than that of K-ras, etc., but st...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/686C12N15/11
Inventor马永丁燕芬丁娜
OwnerZONHON BIOPHARMA INST