Unlock instant, AI-driven research and patent intelligence for your innovation.

Fluorescent quantitative PCR detection material and kit for detecting D/660 branch of influenza D virus

A fluorescence quantitative, influenza virus technology, applied in the direction of DNA/RNA fragment, recombinant DNA technology, microorganism determination/inspection, etc., to achieve the effect of high sensitivity, loss reduction, and economic loss reduction

Inactive Publication Date: 2019-06-25
SOUTH CHINA AGRI UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that chickens and turkeys are not infected with IDV, but serological evidence from human serum samples found that human sera can test positive, so IDV may be a potential public health risk

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative PCR detection material and kit for detecting D/660 branch of influenza D virus
  • Fluorescent quantitative PCR detection material and kit for detecting D/660 branch of influenza D virus
  • Fluorescent quantitative PCR detection material and kit for detecting D/660 branch of influenza D virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Table 1 Fluorescent quantitative PCR primers and probe sequences

[0040]

[0041]

[0042] The known type D influenza virus of sheep is used as the detection material, and the negative control is pure water.

[0043] The fluorescent group of the specific fluorescent probe is a FAM fluorescent group; the quenching group is a BHQ1 quenching group. 1. Sheep influenza D virus RNA extraction

[0044] RNA was extracted using the TRIZOL method. After adding Trizol to the cells or tissues, place them at room temperature for 5 minutes to fully lyse; centrifuge at 12,000 rpm for 5 minutes to discard the precipitate, add Trizol to chloroform, shake and mix, and place at room temperature for 15 minutes; centrifuge at 12,000 rpm at 4°C for 15 minutes, and transfer the upper layer to another centrifuge tube; Add isopropanol (precipitate RNA) and mix well, place at room temperature for 5-10min; centrifuge at 12000rpm at 4°C for 10min, discard the supernatant, RNA si...

Embodiment 2

[0050] Example 2 Fluorescence quantitative PCR standard curve drawing

[0051] The reaction system is 20 μL, including 10 μL of fluorescent quantitative PCR enzyme mixture Luna universaprobeQpcr Mix, 2 μL of template cDNA, H 2 O (Nuclease-free) was supplemented to 20 μL, of which LunauniversaprobeQpcr Mix 10 μL contained 0.8 μL of pre-qPCR primers (10 μM), 0.8 μL of post-qPCR primers (10 μM), and 0.4 μL of probes (10 μM).

[0052] The reaction program was: 95°C pre-denaturation for 60 seconds, then 95°C for 15 seconds, 60°C for 30s and then 40-45 cycles.

[0053] The above-mentioned positive standard sample was calculated as the copy number by measuring the concentration of the positive plasmid, and then used ddH 2 O-fold dilution is 6 concentration gradients 10 -7 -10 -2 copies / μL, 20 μL systems were prepared with these 6 concentration gradients, and the Bio-rad fluorescent quantitative PCR instrument was used for amplification, and the established standard curve was as fo...

Embodiment 3

[0054] The sensitivity experiment of embodiment 3 fluorescence quantitative PCR probe method

[0055] With the positive standard sample described in embodiment 2, then calculate the copy number by measuring the concentration of positive plasmid, then use ddH 2 O-fold dilution is 6 concentration gradients 10 -7 -10 -2 copies / μL, prepare 20 μL systems with these 6 concentration gradients, and perform amplification with Bio-rad fluorescent quantitative PCR instrument. The reaction conditions are as in Example 2, and the results are shown in the appendix. image 3 shown. The extracted positive plasmid was diluted 10 times with ultrapure water, and the content of the plasmid was measured at 260nm and 280nm wavelengths, and the copy number of the plasmid DNA was obtained by the formula: the lowest detection concentration of real-time fluorescent quantitative PCR was 10.09 copies / μL.

[0056]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescent quantitative PCR detection material and kit for detecting a D / 660 branch of an influenza D virus. The material comprises a qPCR front primer, a qPCR rear primer and a specific fluorescent quantitative probe, wherein the sequence of the qPCR front primer is GCAAAGAAGTTTCGGTCATTGTC; the sequence of the qPCR rear primer is CCAGTTTACCCCTTCATAAAATA; the specific fluorescent quantitative probe sequence is fluorophore-AAAAGCCGACAACATCAACGAAGC-quencher. According to a verification result, quantitative detection of the D / 660 branch of the influenza D virus can be achieved by means of combination of the primers and the specific fluorescent quantitative probe as well as the method.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically relates to a fluorescent quantitative PCR detection material and a kit for detecting the D / 660 branch of influenza D virus. Background technique [0002] Influenza virus is an infectious disease that seriously threatens human and animal health. IDV is a single-stranded negative-sense RNA virus with seven genome segments encoding nine proteins: glycoprotein hemagglutinin-esterase fusion protein (HE); polymerases PB2, PB1 and P3; nucleoprotein; matrix protein ( M1 and CM2), and nonstructural proteins (NS1 and NEP). IDV shares less than 50% protein sequence identity with ICV. There was no cross-reactivity between IDV and human ICV-derived sera. In 2014, the Executive Committee of the International Committee on Taxonomy of Viruses approved the naming of a new virus—type D influenza virus, which was proposed as a new member of the Orthomyxoviridae family. [0003] In 2011, IDV wa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
Inventor 罗开健张奇冯赛祥孙海亮王晓冰柳子巍谢嘉渠施建鑫
Owner SOUTH CHINA AGRI UNIV