Unlock instant, AI-driven research and patent intelligence for your innovation.

LAMP detection method and kit for mycoplasma hominis

A technology of Mycoplasma hominis and detection kit, which is applied in the biological field, can solve the problems that liquid culture medium cannot accurately judge Mycoplasma hominis infection, cannot achieve pure separation, cannot judge at the same time, etc., and achieves simple, cheap, repeatable, shortened The effect of detection time and low cost

Pending Publication Date: 2019-06-28
THE THIRD AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIVERSITY
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The liquid culture method and solid culture method are used to detect Mycoplasma hominis. The liquid culture method mainly relies on the decomposition of urea by Mycoplasma hominis to produce alkaline NH 3 , but the liquid medium cannot accurately determine the presence of mycoplasma infection, and there is a certain false positive rate; at the same time, pure separation cannot be achieved, and one liquid medium cannot simultaneously determine more than two kinds of mycoplasma infection, and these two traditional The detection method takes a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP detection method and kit for mycoplasma hominis
  • LAMP detection method and kit for mycoplasma hominis
  • LAMP detection method and kit for mycoplasma hominis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] 1. Genomic DNA extraction

[0072] Balance the strains stored at -70°C at room temperature and inoculate them into mycoplasma solid medium and liquid medium, cultivate them in a 37°C incubator for about 36-48 hours, take the bacteria in the liquid medium and wash them with PBS to make 1ml of bacterial suspension liquid. The next steps were performed according to the instructions of the bacterial genomic DNA extraction kit, and the concentration and purity of the extracted samples were measured on a DNA concentration tester.

[0073] 2. LAMP primer design and synthesis

[0074] (1) According to the gap genes gene sequence (SEQ ID NO.1) of Mycoplasma hominis (Mh), primers were designed. Such as figure 1 shown.

[0075] The gap genes gene sequence (SEQ ID NO.25, 444bp) is:

[0076] ATGACAACAGTCCACTCATATACAGCAGACCAAAGATTACAAGATGCTCCACACAAAGATTTAAGAAGAGCAAGAGCAGCTGCTTCAAACATGGTTCCAACAACAACTGGTGCTGCAATAGCAATTGGAAAGGTTATCCCTTCATTGGATAAAAAACTAAATGGACTATCTTTAAGAGTTCCAACAATA...

Embodiment 2

[0099] 1. Specificity test

[0100] Genomic DNA of Mycoplasma hominis and other common clinical pathogens was extracted, amplified according to the reaction conditions of Real-LAMP, the detection signal was analyzed, and the specificity of the primer was evaluated.

[0101] Other relevant clinical bacteria of Mycoplasma hominis are: Staphylococcus hemolyticus, Escherichia coli, Pseudomonas aeruginosa, Mycoplasma hominis, Klebsiella pneumoniae, Proteus mirabilis, Streptococcus agalactiae, Enterococcus aeruginosa. The result is as Figure 9 shown. It can be seen that the common pathogenic bacteria selected in the test of the Mycoplasma hominis system did not appear to be amplified, and the DNA of Mycoplasma hominis could be detected, indicating that the specificity of the primers for the detection of Mycoplasma hominis is good, and it is different from non-target bacteria. There is cross-reactivity.

[0102] 2. Sensitivity test

[0103] To measure the concentration of the DN...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a LAMP detection method and a kit for mycoplasma hominis. 4 or 6 specific primers are designed for 6 or 8 regions of a gap genes sequence gene of the mycoplasma hominis, a LAMPdetection primer group is obtained through creative labor design of an inventor, is used for detecting the mycoplasma hominis in a sample and has the characteristics of rapidness, accuracy, simplicity, cheapness, repeatability, good specificity and high sensitivity. The detection line reached 42 pg per microliter.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a LAMP detection method and a kit for mycoplasma hominis. Background technique [0002] Mycoplasma hominis (Mh), Ureaplasma urealyticum (Uu) and Mycoplasma genitalium (Mg) in mycoplasma can cause laboratory cell contamination, or cause human diseases, such as: genitourinary tract Mycoplasma infection, pelvic inflammatory disease, etc. [0003] Currently commonly used laboratory detection methods for Mycoplasma hominis include: morphological examination, mycoplasma culture, antigen detection, serological methods, etc. The liquid culture method and solid culture method are used to detect Mycoplasma hominis. The liquid culture method mainly relies on the decomposition of urea by Mycoplasma hominis to produce alkaline NH 3 , but the liquid medium cannot accurately determine the presence of mycoplasma infection, and there is a certain false positive rate; at the same time, pure separati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11
Inventor 夏勇劳梦晓郭旭光汤昕林丽英李磊
Owner THE THIRD AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIVERSITY