Unlock instant, AI-driven research and patent intelligence for your innovation.

Panax ginseng pgmyb2 transcription factor and its application in regulating ginsenoside synthesis

A technology of ginseng and synthetic enzymes, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problem of low content

Active Publication Date: 2022-05-13
CENT SOUTH UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although many ginsenoside monomers have activities such as anti-tumor, anti-aging, inhibiting cell apoptosis, and enhancing immunity, most of the active ginsenosides are extremely low in ginseng, which is far from meeting market demand. The bottleneck depends on in-depth study of the regulatory mechanism of ginsenoside biosynthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Panax ginseng pgmyb2 transcription factor and its application in regulating ginsenoside synthesis
  • Panax ginseng pgmyb2 transcription factor and its application in regulating ginsenoside synthesis
  • Panax ginseng pgmyb2 transcription factor and its application in regulating ginsenoside synthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Cloning of the PgMYB2 gene

[0035] 1. Establishment of Ginseng Hairy Root Culture System

[0036] 1.1 Configuration of 1 / 2MS solid and liquid medium:

[0037] ① Preparation of mother liquor

[0038] a. 10×major element mother liquor

[0039]

[0040] ddH 2 Dissolve O, and finally dilute to 1L, store at 4°C after sterilization;

[0041] b.200×trace element mother liquor

[0042]

[0043] ddH 2 Dissolve O, and finally dilute to 500mL, store at 4°C;

[0044] c.100×organic mother liquor

[0045]

[0046] ddH 2 Dissolve O, and finally dilute to 500mL, store at 4°C;

[0047] d.100× iron salt mother liquor

[0048] Na 2 EDTA·2H 2 O 3.725g

[0049] FeSO 4 ·7H 2 O 2.785g

[0050] ddH 2 O was dissolved, and the final volume was adjusted to 1 L, and stored in a brown bottle at 4°C.

[0051] ② 1 / 2MS medium formula

[0052]

[0053] ③Preparation of culture medium

[0054] According to the amount in the table, add various mother liquors first, then ad...

Embodiment 2

[0105] Subcellular localization and expression analysis of PgMYB2

[0106] 1 Agrobacterium-mediated subcellular localization of PgMYB2 in the inner epidermis of onion

[0107] 1.1 PCR amplification

[0108] Primers with vector homology arms at both ends were synthesized in Invitrogen, and amplified with Converse TaqMasterMix:

[0109] Primer Sequence(5'→3')

[0110] 1302-PgMYB2-F AGAACACGGGGGACTCTTGACCAAGAAGAAATTGACGACGATG (SEQ ID NO. 5)

[0111] 1302-PgMYB2-R GTGAAAAGTTCTTCTCCTTTACTATTCCTTTTCCCAACAGTCC (SEQ ID NO. 6)

[0112] reaction system:

[0113]

[0114] PCR reaction conditions:

[0115]

[0116] 1.2 Purification of the product

[0117] The kit used was Wizard SV Gel and PCR Clean-up system kit (Promega). Refer to the manual for gel cutting and recovery.

[0118] 1.3 Enzyme digestion system

[0119]

[0120] 1.4 Homologous recombination of purified product and expression vector

[0121] Connect using ClonExpress TM II one step cloning kit (Vazyme) fo...

Embodiment 3

[0158] Analysis of the interaction between PgMYB2 and DDSpro

[0159] 1 PCR amplification

[0160] The primers with enzyme cutting sites synthesized in Beijing Ruibo Xingke Biotechnology Co., Ltd. were amplified with TransStartFastPfu DNAPolymerase.

[0161] A. Promoter sequence amplification:

[0162]

[0163] reaction system:

[0164]

[0165] PCR reaction program:

[0166]

[0167] B. PgMYB2 gene amplification:

[0168] Primer Sequence(5'→3')

[0169] pGADT7-PgMYB2-F CATATGGCCATGGAGGCCAGTATGATGGGACGTTCACCTTGC (SEQ ID NO. 15)

[0170] pGADT7-PgMYB2-R ATCTGCAGCTCGAGCTCGATGTCTATTTCCTTTTCCCAACAGTCC (SEQ ID NO. 16)

[0171] reaction system:

[0172]

[0173] Reaction procedure:

[0174]

[0175] 2 PCR product gel recovery

[0176] The kit used was Wizard SV Gel and PCR Clean-up system kit (Promega). Refer to the manual for gel cutting and recovery.

[0177] 3 Cloning the target gene into the pGADT7 vector by Gibson method, and cloning the DDS gene into t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a transcription factor PgMYB2 capable of regulating ginseng dammarenediol synthase gene (PgDDS). The protein sequence of the transcription factor is shown as SEQ ID NO.1. The nucleotide sequence encoding the above protein is SEQ ID NO.2. The present invention also studies the relationship between the transcription factor and the expression of the mesenediol synthase gene (PgDDS), and finds that the PgMYB2 transcription factor can combine with a specific sequence in the PgDDS promoter to promote the expression of PgDDS and further enhance the activity of ginsenosides. Synthesis and accumulation, by studying the application of PgMYB2 transcription factor in the regulation of ginsenoside synthesis, it provides a new strategy for the future construction of transgenic ginseng cells, hairy roots and plants by genetic engineering and metabolic engineering, thereby increasing the production of ginsenosides.

Description

technical field [0001] The invention belongs to the technical field of biogenetic engineering, and relates to the regulating effect of transcription factors on target genes, in particular to the effect of ginseng PgMYB2 transcription factor promoting the expression of dammarenediol synthase (DDS) gene. The invention aims to realize the improvement of saponin synthesis and accumulation level by revealing the regulation mechanism of key enzymes in the ginsenoside synthesis pathway, and has important application value. Background technique [0002] Ginseng (Panax ginseng C.A. Meyer) is a perennial herb with high medicinal value. The main medicinal ingredients in ginseng are ginsenosides. At present, more than 50 kinds of ginsenoside monomers have been isolated from ginseng roots. medicinal value, such as Rb 1 and Rg 1 Has anti-aging effects, Ra 1 , Rg 3 and Rh 2 Some ginsenosides have been widely used clinically due to their strong anticancer activity. Although many gins...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/11C12N15/82A01H6/00
CPCC07K14/415C12N15/8243
Inventor 罗志勇刘拓郭祥前罗眺李继佳
Owner CENT SOUTH UNIV