Application of PQBP1 in ovarian cancer diagnosis and treatment
A technology for ovarian cancer and ovarian cancer cells, which is applied in the fields of biomedicine and molecular biology, can solve the problems of reducing associations and changes in alternative splicing patterns, achieving strong targeting, promoting proliferation, invasion and migration, and inhibiting apoptosis Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Example 1 Defining the role of PQBP1 in ovarian cancer
[0060] The research team found that PQBP1 was highly expressed in HGSOC through transcriptome and proteomic analysis in the early stage. We further expanded the sample for verification, using 16 cases of normal ovarian fimbria tissue collected and 29 cases of high-grade serous ovarian cancer tissue to extract tissue RNA , the relative expression of PQBP1 mRNA was detected by qPCR, and it was found that the mRNA expression of PQBP1 in high-grade serous ovarian tissue was significantly higher than that in normal fimbria tissue (Pfigure 1 B). TCGA database analysis found that PQBP1 had gene amplification and high mRNA expression (11%) in HGSOC. Further analysis found that patients with high expression of PQBP1 had a poor prognosis, and patients with low expression of PQBP1 had a good prognosis ( figure 1 A and 1C). In summary, PQBP1 is highly expressed in high-grade serous ovarian cancer and is closely related to th...
Embodiment 2
[0061] Example 2 PQBP1 overexpression and knockdown plasmid construction
[0062] 1. Overexpression plasmid construction:
[0063] Purchase PQBP1 overexpression plasmid from Addgene official website. First, the PQBP1 target gene sequence was constructed on the intermediate vector PCDNA3.1 vector, and then connected to the lentiviral vector PCMV through the BamHI restriction site and the XhoI restriction site.
[0064] 2. Knockdown plasmid construction:
[0065] The shRNA sequence corresponding to PQBP1 retrieved from the Sigma official website is as follows:
[0066] Forward oligos:
[0067] 5'CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTTTG3';
[0068] Reverse oligo:
[0069] 5'AATTCAAAAACCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGG3';
[0070] Then the sequence was constructed on the PLKO.1 vector through restriction sites AgeI and EcoRI. The overexpression and knockdown plasmids were transiently transfected into functional cells 293T, and the RNA was col...
Embodiment 3
[0071] Example 3 Biological functions of PQBP1 in ovarian cancer cells
[0072]The sequence of PQBP1 was ligated to the PCMV plasmid (purchased from the official website of OriGene), and the lentivirus was packaged and transfected into A2780 and SKOV3 cells, and screened with puromycin. After screening, the content of PQBP1 was detected by western blot and qPCR. After the cell line was successfully constructed, the cell proliferation ability was detected by the plate clone assay, and the cell invasion ability was detected by the Transwell assay.
[0073] 1. Construction of stable cell lines:
[0074] (1) Production of virus particles
[0075] Take Phoenix amphotropic cells in good condition, collect cells by trypsinization, count them, and inoculate them in a 100mm cell culture dish at a density of 3×106 cells / dish. Culture overnight, observe when the cell density reaches 70%-80% for plasmid transfection;
[0076] Prepare the transfection complex: Dilute 10 μg of plasmid...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


