Application of PQBP1 in ovarian cancer diagnosis and treatment

A technology for ovarian cancer and ovarian cancer cells, which is applied in the fields of biomedicine and molecular biology, can solve the problems of reducing associations and changes in alternative splicing patterns, achieving strong targeting, promoting proliferation, invasion and migration, and inhibiting apoptosis Effect

Active Publication Date: 2019-08-16
SHANDONG UNIV
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Loss-of-function PQBP1 reduces SF3B1 association with substrate mRNAs, leading to dramatic changes in alternative splicing patterns
The expression level of PQBP1 is up-reg...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of PQBP1 in ovarian cancer diagnosis and treatment
  • Application of PQBP1 in ovarian cancer diagnosis and treatment
  • Application of PQBP1 in ovarian cancer diagnosis and treatment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1 Defining the role of PQBP1 in ovarian cancer

[0060] The research team found that PQBP1 was highly expressed in HGSOC through transcriptome and proteomic analysis in the early stage. We further expanded the sample for verification, using 16 cases of normal ovarian fimbria tissue collected and 29 cases of high-grade serous ovarian cancer tissue to extract tissue RNA , the relative expression of PQBP1 mRNA was detected by qPCR, and it was found that the mRNA expression of PQBP1 in high-grade serous ovarian tissue was significantly higher than that in normal fimbria tissue (Pfigure 1 B). TCGA database analysis found that PQBP1 had gene amplification and high mRNA expression (11%) in HGSOC. Further analysis found that patients with high expression of PQBP1 had a poor prognosis, and patients with low expression of PQBP1 had a good prognosis ( figure 1 A and 1C). In summary, PQBP1 is highly expressed in high-grade serous ovarian cancer and is closely related to th...

Embodiment 2

[0061] Example 2 PQBP1 overexpression and knockdown plasmid construction

[0062] 1. Overexpression plasmid construction:

[0063] Purchase PQBP1 overexpression plasmid from Addgene official website. First, the PQBP1 target gene sequence was constructed on the intermediate vector PCDNA3.1 vector, and then connected to the lentiviral vector PCMV through the BamHI restriction site and the XhoI restriction site.

[0064] 2. Knockdown plasmid construction:

[0065] The shRNA sequence corresponding to PQBP1 retrieved from the Sigma official website is as follows:

[0066] Forward oligos:

[0067] 5'CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTTTG3';

[0068] Reverse oligo:

[0069] 5'AATTCAAAAACCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGG3';

[0070] Then the sequence was constructed on the PLKO.1 vector through restriction sites AgeI and EcoRI. The overexpression and knockdown plasmids were transiently transfected into functional cells 293T, and the RNA was col...

Embodiment 3

[0071] Example 3 Biological functions of PQBP1 in ovarian cancer cells

[0072]The sequence of PQBP1 was ligated to the PCMV plasmid (purchased from the official website of OriGene), and the lentivirus was packaged and transfected into A2780 and SKOV3 cells, and screened with puromycin. After screening, the content of PQBP1 was detected by western blot and qPCR. After the cell line was successfully constructed, the cell proliferation ability was detected by the plate clone assay, and the cell invasion ability was detected by the Transwell assay.

[0073] 1. Construction of stable cell lines:

[0074] (1) Production of virus particles

[0075] Take Phoenix amphotropic cells in good condition, collect cells by trypsinization, count them, and inoculate them in a 100mm cell culture dish at a density of 3×106 cells / dish. Culture overnight, observe when the cell density reaches 70%-80% for plasmid transfection;

[0076] Prepare the transfection complex: Dilute 10 μg of plasmid...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides application of PQBP1 in ovarian cancer diagnosis and treatment. The researches of the invention discovers that PQBP1 is high in expression in ovarian cancer patients, and in-vivo and in-vitro functional tests show that the PQBP1 can promote the proliferation and invasive migration of ovarian cancer cells. In addition, the researches discover that the PQBP1 can affect the selective splicing of endogenous Bcl-x, to be more specific, the PQBP1 can promote the expression of apoptosis inhibiting transcript Bcl-xL and inhibit the expression of apoptosis promoting transcript Bcl-xS to finally inhibit the apoptosis of the ovarian cancer cells. The researches show that the PQBP1 is a splicing factor participating in ovarian cancer occurrence and development, can be used as the biological marker and treatment target of ovarian cancer and has a good actual application value.

Description

technical field [0001] The invention belongs to the technical fields of biomedicine and molecular biology, and specifically relates to the application of PQBP1 in the diagnosis and treatment of ovarian cancer. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] Ovarian cancer is a common malignant tumor of female reproductive organs, and its case fatality rate has always been the first among gynecological malignant tumors. High-grade serous ovarian cancer (High-grade Serous Ovarian Cancer, HGSOC) is the most malignant subtype, accounting for 70% to 80% of ovarian cancer, and has the characteristics of insidious onset, strong invasion ability, and poor prognosis. Due to the l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6886G01N33/574A61K31/713A61P35/00
CPCA61K31/713A61P35/00C12Q1/6886C12Q2600/118C12Q2600/136C12Q2600/158G01N33/57449G01N2333/4704
Inventor 刘招舰张娇娇张锡宇王守荣田晓雪秦君超
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap