Rice temperature-sensitive nuclear sterility gene tms3 mutant and its molecular marker and application thereof
A technology of temperature-sensitive nuclei and mutants, applied in the fields of application, genetic engineering, and plant gene improvement, to achieve the effects of increasing rice yield, accelerating the breeding process, and quickly cultivating
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1 Obtaining and phenotypic analysis of rice temperature-sensitive male sterility gene tms3 mutant 1. tms3 regulates pollen fertility and is regulated by temperature
[0038] In the present invention, four temperature and light combinations are set in the light incubator, and the culture conditions are: 28°C+14h light; 28°C+10h light; 22°C+14h light; 22°C+10h light.
[0039] The ZS97 and MZ2 plants in the stage of pollen mother cell formation were treated for 7 days, and then transferred to the normally managed field for planting. Investigating the pollen fertility of plant spikelets, it was found that ZS97 had normal and fertile pollen in all treatments, while MZ2 showed normal and fertile pollen only under low temperature conditions, and showed no pollen phenotype under high temperature conditions ( figure 1 ).
[0040] By treating ZS97 and MZ2 with different light time and temperature, it was confirmed that the pollen fertility of the MZ2 mutant was mainly re...
Embodiment 2
[0051] Obtaining of embodiment 2 tms3 molecular marker
[0052] In the 23.3-kb candidate gene region of tms3, this example compared and sequenced ZS97 and MZ2, and found that there was only one single base deletion difference between the two: MZ2 was at the 75th position of the tms3 gene shown in SEQ ID NO.3 A base G is missing. The applicant developed this single base variation into a KASP (Kompetitive Allele Specific PCR) marker for gene selection. The developed marker marker K_tms3-75 has the following sequence:
[0053] K_tms3-75S, TCCGTCGCCGTCACTCTCC (SEQ ID NO. 4)
[0054] K_tms3-75F, CCGTCGCCGTCACTCTCG (SEQ ID NO. 5)
[0055] The general primer sequence is: CTGCTGCTGGGAGCGCGAGA (SEQ ID NO.6).
[0056] The 5' of two specific primers were respectively connected to the FAM or HEX linker sequence of LGC Company. The KASP reaction system refers to the KASP Master Mix reagent manual, and the result detection uses its supporting LGC SNP line genotyping platform.
[0057]...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com