Rice temperature-sensitive nuclear sterility gene tms3 mutant and its molecular marker and application thereof

A technology of temperature-sensitive nuclei and mutants, applied in the fields of application, genetic engineering, and plant gene improvement, to achieve the effects of increasing rice yield, accelerating the breeding process, and quickly cultivating

Active Publication Date: 2019-09-06
HUAZHONG AGRI UNIV
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these genes cannot fully meet the requirements of breeding practice, and more photothermosensitive male sterility genes still need to be discovered

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice temperature-sensitive nuclear sterility gene tms3 mutant and its molecular marker and application thereof
  • Rice temperature-sensitive nuclear sterility gene tms3 mutant and its molecular marker and application thereof
  • Rice temperature-sensitive nuclear sterility gene tms3 mutant and its molecular marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Obtaining and phenotypic analysis of rice temperature-sensitive male sterility gene tms3 mutant 1. tms3 regulates pollen fertility and is regulated by temperature

[0038] In the present invention, four temperature and light combinations are set in the light incubator, and the culture conditions are: 28°C+14h light; 28°C+10h light; 22°C+14h light; 22°C+10h light.

[0039] The ZS97 and MZ2 plants in the stage of pollen mother cell formation were treated for 7 days, and then transferred to the normally managed field for planting. Investigating the pollen fertility of plant spikelets, it was found that ZS97 had normal and fertile pollen in all treatments, while MZ2 showed normal and fertile pollen only under low temperature conditions, and showed no pollen phenotype under high temperature conditions ( figure 1 ).

[0040] By treating ZS97 and MZ2 with different light time and temperature, it was confirmed that the pollen fertility of the MZ2 mutant was mainly re...

Embodiment 2

[0051] Obtaining of embodiment 2 tms3 molecular marker

[0052] In the 23.3-kb candidate gene region of tms3, this example compared and sequenced ZS97 and MZ2, and found that there was only one single base deletion difference between the two: MZ2 was at the 75th position of the tms3 gene shown in SEQ ID NO.3 A base G is missing. The applicant developed this single base variation into a KASP (Kompetitive Allele Specific PCR) marker for gene selection. The developed marker marker K_tms3-75 has the following sequence:

[0053] K_tms3-75S, TCCGTCGCCGTCACTCTCC (SEQ ID NO. 4)

[0054] K_tms3-75F, CCGTCGCCGTCACTCTCG (SEQ ID NO. 5)

[0055] The general primer sequence is: CTGCTGCTGGGAGCGCGAGA (SEQ ID NO.6).

[0056] The 5' of two specific primers were respectively connected to the FAM or HEX linker sequence of LGC Company. The KASP reaction system refers to the KASP Master Mix reagent manual, and the result detection uses its supporting LGC SNP line genotyping platform.

[0057]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a rice temperature-sensitive nuclear sterility gene tms3 mutant and its molecular marker and an application thereof. The rice temperature-sensitive nuclear sterility gene tms3 is subjected to map-based cloning, and the function of the gene is verified by genetic transformation. The nucleotide sequence of the temperature-sensitive male fertility gene tms3 mutant provided by the present invention is shown as SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2. A Crispr technology is used to induce the loss of tms3 gene function in normal rice varieties to obtain mutant plants, and a thermosensitive male sterility line can be cultivated, which proves that the gene has important application value. The invention also provides the molecular marker closely linked to the tms3 gene, and the molecular marker can be used to detect tms3, and the application in the cultivation of the temperature-sensitive nuclear sterility and the rice two-line sterile line can be realized.

Description

technical field [0001] The invention belongs to the field of crop molecular biology, and in particular relates to a rice thermosensitive sterility gene tms3 mutant and its molecular marker and application. Background technique [0002] Rice provides the main food source for nearly half of the world's population. With the increase of population and the decrease of arable land, improving rice yield is still the most important breeding goal. The hybrid rice bred by the two-line method and the three-line method is widely planted in China and many countries, providing a strong guarantee for world food security (Fan Yourong et al. 2016). Compared with three-line hybrid rice, two-line male sterile lines can be combined freely, restorer lines are wide, and the process of hybrid seed production is simplified, occupying an increasingly important position in hybrid rice production (Si Huamin et al. 2011). In addition, the fertility of the two-line male sterile line is controlled by n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/11C12N15/82C07K14/415C12Q1/6895A01H5/00A01H6/46
CPCC07K14/415C12N15/8289C12Q1/6895C12Q2600/13
Inventor余四斌袁志阳蔡星星凡凯田莉邱先进
OwnerHUAZHONG AGRI UNIV