A novel oncolytic virus and its preparation method and application

An oncolytic virus, a new type of technology, applied in the field of biomedicine, can solve problems such as weakening inhibitory activity, and achieve the effects of improving killing function, good targeting and anti-tumor effect, and good application prospects

Active Publication Date: 2021-10-22
SHANGHAI PUBLIC HEALTH CLINICAL CENT
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Antibodies against CTLA4 mediate killing of effector Treg cells and impair their suppressive activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A novel oncolytic virus and its preparation method and application
  • A novel oncolytic virus and its preparation method and application
  • A novel oncolytic virus and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Construction and expression verification of recombinant vaccinia virus rTV-mIL-21 of mouse IL-21

[0033] 1.1 Construction of pSC65 vector with mouse IL-21 gene of interest

[0034] The DNA sequence of mouse-derived IL-21 was artificially synthesized. The synthetic sequence is shown in SEQ ID NO: 1, and its amino acid sequence is shown in SEQ ID NO: 2. Using the synthetic DNA sequence as a template, the following primers were used for PCR amplification .

[0035] The primers for amplification are:

[0036] Mouse-derived IL-21-F: GTACCAGGCCTAGTACTATGGAGAGGACCCTTGTCTG

[0037] Mouse-derived IL-21-R: AATAAGCTCGAAGTCGAC CTAGGAGAGATGCTGATG

[0038] PCR reaction program: pre-denaturation at 94°C for 5 minutes; denaturation at 98°C for 10 seconds, 58°C: annealing for 30 seconds, extension at 72°C for 1 minute, and 30 cycles of reaction; 72°C loop extension for another 10 minutes, and terminated at 25°C.

[0039] Recovery of PCR products and clone construction:...

Embodiment 2

[0058] Example 2: Anti-melanoma effect of mouse IL-21 recombinant vaccinia virus

[0059] 2.1 Amplification and purification of mouse IL-21 recombinant vaccinia virus

[0060] 1. VERO cell plating: 10 cm dish, each dish about 5×10 6 It is advisable to ensure that the cell density reaches 100% when the vaccinia virus is inoculated the next day;

[0061] 2. Before virus inoculation, the complete medium needs to be replaced with 8 mL of maintenance medium (DMEM medium + 2% FBS + 1% PS), and the virus is inoculated into the cells in the maintenance medium at an MOI of about 0.02 (MOI= virus PFU / cell number). Continue to incubate in an incubator at 37°C and 5% CO2 for about 48 hours, and collect samples according to the formation of virus plaques;

[0062] 3. To collect vaccinia virus: Discard 8 mL of medium in the dish, take 2 mL of maintenance medium to blow off the remaining cells, and collect in a 15 mL centrifuge tube;

[0063] 4. After freezing for 24 hours, freeze ...

Embodiment 3

[0080] Example 3: In vivo anti-glioma effect of mouse IL-21 recombinant vaccinia virus

[0081] 1. For C57BL / 6 mice by subcutaneous implantation 1×10 6 Glioma GL261 cells (125 x 25), the long and short diameters of the tumors of the mice were recorded every day, and the volume of the tumor was calculated using the following formula.

[0082] 2. Tumor volume calculation formula: tumor volume (mm 3 ) = (long diameter × wide diameter 2 ) / 2.

[0083] 3. Seven days after the mice were inoculated with glioma GL261 cells, the tumor-forming mice were randomly divided into three groups (5 mice in each group), which were the control group and the wild-type vaccinia virus Tiantan strain (TV) treatment group Recombinant vaccinia virus (rTV-mIL-21) treatment group with mouse IL-21. The administration method of the oncolytic virus is intratumoral injection and reinfusion, and it is obtained from the purified oncolytic virus in Example 2, and is administered once.

[0084] A: Control gr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel oncolytic virus and its preparation method and application. The oncolytic virus genome contains gene coding sequences of anti-human CTLA4 antibody and human IL-21, and can express anti-human CTLA4 antibody and human IL-21 21. Combining the tumor-suppressing effect of immunotherapy with the oncolytic effect of viral therapy, an oncolytic virus capable of highly expressing the αCTLA4-Fc(ALIE)-IL21 gene was prepared, and the oncolytic virus exerted an oncolytic effect to lyse the tumor At the same time, it can kill regulatory T cells (Regulatory T Cells, Treg) in the tumor microenvironment by expressing a large amount of αCTLA4‑Fc (ALIE), or block its inhibitory effect, thereby up-regulating the immune response of the tumor microenvironment and improving the anti-tumor effect At the same time, the oncolytic virus expresses a large amount of IL21, further activates the killing function of T cells and NK cells in the tumor microenvironment, and exerts multiple anti-tumor effects. Compared with simple gene therapy or virus therapy, it has enhanced its ability to kill malignant tumors.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and specifically relates to a novel oncolytic virus comprising a modified or engineered highly lethal anti-human CTLA4 antibody and a human IL-21 gene, a preparation method of the oncolytic virus, and an anti-tumor effect application. Background technique [0002] Due to the limited therapeutic effect and severe side effects of standard cancer treatment regimens in the treatment of advanced tumors, tumor-targeting oncolytic viruses have attracted great attention in recent decades. Oncolytic viruses benefit from their own characteristics of selectively infecting and lysing tumor cells locally in tumors, and are increasingly becoming the first choice for anti-tumor. The tumor selectivity of oncolytic viruses can be either their own tumor tropism or the result of genetic modification. Oncolytic viruses can act on multiple cellular pathways to reduce tumor resistance and induce different forms ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N7/01C12N15/63A61K48/00A61K38/20A61K39/395A61P35/00
CPCA61K38/20A61K39/39558A61K48/0025A61K48/005A61P35/00C07K14/54C07K16/2818C12N7/00A61K2300/00
Inventor徐建青张晓燕丁相卿陈晔陈添悦廖启彬
OwnerSHANGHAI PUBLIC HEALTH CLINICAL CENT