Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Test strip for detecting extractable tetracycline antibiotics in soil by using biosensor and method thereof

A biosensor and tetracycline technology, applied in the field of test strips for extractable tetracycline antibiotics, can solve problems such as tetracycline antibiotics that have not yet been discovered, and achieve the effects of easy promotion and use, low cost, and portability

Active Publication Date: 2019-09-20
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, no method has been found to use whole-cell biosensors to prepare test strips to assess tetracycline antibiotics in soil

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test strip for detecting extractable tetracycline antibiotics in soil by using biosensor and method thereof
  • Test strip for detecting extractable tetracycline antibiotics in soil by using biosensor and method thereof
  • Test strip for detecting extractable tetracycline antibiotics in soil by using biosensor and method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0058] 1. Preparation of Escherichia coli BL21 / pMTLacZ strain:

[0059] (1) The gene sequence of the pMT fragment (5256bp) of the tetracycline-mediated regulatory system cloned from the plasmid pMTmCherry into Staphylococcusrostri RST11: Tn916 and the transposon Tn10 by using primer polymerase chain reaction (PCR), the annealing temperature is 55 ℃ ( figure 1 ). The plasmids used are shown in Table 1.

[0060] Bacteria and plasmids used in Table 1

[0061]

[0062] The forward primer sequence and reverse primer sequence of the pMT primer are shown in SEQ ID No.1 and SEQ ID No.2,

[0063] SEQ ID No. 1: TCGTGCCAGCTGCATTAAT

[0064] SEQ ID No. 2: TTCACTTTTCTCTATCACTGATAGG;

[0065] (2) Cloning the gene sequence of the LacZ (368bp) reporter gene fragment from the pCU19 plasmid by using primer polymerase chain reaction (PCR), the annealing temperature is 65°C; the gene sequence of the T7 fragment (220bp) cloned in the plasmid pMTmCherry, annealed The temperature is 60°C; th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a test strip for detecting extractable tetracycline antibiotics in soil by using a biosensor and a method thereof. The test strip comprises a filter paper strip, a fixing liquid, a sensitizer and a tetracycline biosensor bacteria inoculant, and the test paper is obtained by cutting a common filter paper purchased by the market. The tetracycline biosensor bacteria inoculant is the Escherichia coli BL21 strain carrying the pMTLacZ plasmid (ie Escherichia coli BL21 / pMTLacZ strain). The pMTLacZ plasmid is the synthetic plasmid independently designed by the inventors and can be induced by various tetracycline antibiotics. The pMTLacZ plasmid can produce different amounts of beta-galactosidase under the induction of different concentrations of tetracycline, can degrade an X-gal developer fixed on the test strip, and can visually display the concentration of tetracycline antibiotics in a sample. The method for simultaneously detecting the six extractable tetracyclines in the soil by using the test strip of the invention is simple, rapid, intuitive, accurate, portable, environmentally friendly, wide in application range, low in cost, and easy to popularize and use.

Description

technical field [0001] The invention belongs to the technical field of biological analysis and detection, and in particular relates to a test strip and a method for detecting extractable tetracycline antibiotics in soil by using a biosensor. Background technique [0002] With the increasing degree of industrialization and the sudden occurrence of various chemical products polluting soil, the number of various chemical substances has increased sharply, which has a great impact on the living environment of human beings. It is urgent to identify the acute toxicity of the increasing environmental pollutants. [0003] Tetracyclines have broad-spectrum and high-efficiency bactericidal and antibacterial effects, can be mixed with most drugs or feed additives, and have been widely used in livestock and poultry production. However, excessive use inevitably causes serious drug residues in livestock and poultry manure, which enters the soil environment through manure fertilization, bec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/18C12N15/70C12R1/19
CPCC12N15/70C12Q1/18G01N2333/245
Inventor 高彦征马钊
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com