Check patentability & draft patents in minutes with Patsnap Eureka AI!

Pharmaceutical composition and food for preventing or treating oral diseases

A technology of composition and medicine, applied in the field of pharmaceutical composition and food for prevention or treatment of oral diseases, to achieve the effect of reducing thickness and density, and reducing the amount of adhesion

Inactive Publication Date: 2019-11-15
BEIJING TECHNOLOGY AND BUSINESS UNIVERSITY
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The strains Lactobacillus paracasei L9 and Staphylococcus salivarius LD11 used in this study are probiotic strains isolated from the feces of long-lived elderly people. Experiments have proved that the strains have high safety, but they have not been used in oral research.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pharmaceutical composition and food for preventing or treating oral diseases
  • Pharmaceutical composition and food for preventing or treating oral diseases
  • Pharmaceutical composition and food for preventing or treating oral diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Embodiment 1——in vitro inhibition of adhesion of Lactobacillus paracasei L9 and Staphylococcus salivarius LD11 to oral pathogenic bacteria

[0047] Specific primers capable of amplifying Streptococcus mutans and Streptococcus gordii, but not Lactobacillus paracasei, were screened by quantitative PCR—forward primer (5′-3′) sequence: GCCTACAGCTCAGAGATGCTATTCT, reverse primer (5'-3') sequence: GCCATACACCACTCATGAATTGA. The primer reaction system and reaction conditions are: 2.5 μl DNA, 10 μl Taq enzyme, 0.5 μl upstream primer, 0.5 μl downstream primer, 6.5 μl ultrapure water; pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 5 seconds, annealing at an annealing temperature of 60°C 60s, 72°C extension for 30s, 40 cycles; 72°C extension for 5 min.

[0048] Use the above-mentioned specific primers to carry out quantitative PCR amplification of pathogenic bacteria, perform agarose gel electrophoresis on the product, cut the gel and recover the DNA using a gel re...

Embodiment 2

[0063] Example 2——Influence of Lactobacillus paracasei L9 and Staphylococcus salivarius LD11 on the diversity of oral flora in mice

[0064] Streptococcus mutans 1.2499, Lactobacillus paracasei L9, and Staphylococcus salivarius LD11 stored at -20°C were respectively activated in 10ml of BHI, MRS, and M17 broth medium for three generations at 37°C, centrifuged at 4500r / min for 10min, and the supernatant was removed Streptococcus mutans was redissolved in sterile saline, Lactobacillus paracasei L9 and Staphylococcus salivarius LD11 were redissolved in sucrose solution, and the concentration of the bacterial solution was adjusted to 10 8 cfu / ml, stored at 4°C for later use.

[0065] Mice dental caries modeling method:

[0066] The animal model of the present embodiment has selected 28 male SPF level BALB / c mice of 3 weeks old purchased from Weitong Lihua, 7 in each group, divided into control group, model group, Lactobacillus paracasei L9 group and Staphylococcus salivarius LD1...

Embodiment 3

[0095] Embodiment 3——Influence of Lactobacillus paracasei L9 on the diversity of human oral flora

[0096] To recruit staff:

[0097] (1) Inclusion criteria

[0098] ① Subjects without active caries

[0099] ②Without any systemic diseases

[0100] ③ Subjects without any history of preventive dental treatment

[0101] (2) Exclusion criteria

[0102] ①Those who received antibiotic treatment during the study

[0103] ② People who used any other probiotic supplements (yogurt or other supplements containing probiotics) during the study

[0104] ③ Subjects who used xylitol products 1 week before the start of the experiment and during the study

[0105] ④ Subjects with a history of intraoral surgery within 6 months before the start of the experiment

[0106] ⑤ Current smokers or smokers one year before the start of the experiment

[0107] (3) Requirements for subjects during the experiment

[0108] Subjects were required to take a probiotic tablet in the morning (before 9:00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pharmaceutical composition and food for preventing or treating oral diseases. Both the composition and food comprise lactobacillus paracasei L9 and staphylococcus salivariusLD11. Studies show that the L9 and the LD11 can significantly alleviate the occurrence degree of E-level dental caries of an occlusal surface, after the composition and food containing the L9 and LD11are taken, the structures of oral floras change significantly, especially actinomycetes are significantly increased, and klebsiella, aerococcus, Gemella, corynebacterium and pseudomonas aeruginosa are significantly reduced in the category classification level. Taking of the L9 and LD11 can significantly reduce saliva species richness, the relative abundances of bacteria related to the oral diseases such as staphylococcus salivarius, actinomycetaceae and peptostreptococcus are significantly reduced, and periodontitis diseases may be alleviated; the species diversity of a dental plaque flora issignificantly reduced, the relative abundances of leptotrichia, fusobacterium and flavobacterium are all significantly reduced, and the oral diseases such as periodontal diseases, ozostomia and dental caries may be alleviated.

Description

technical field [0001] The invention belongs to the field of prevention and treatment of oral diseases, in particular to a pharmaceutical composition and food for preventing or treating oral diseases. Background technique [0002] With the improvement of the quality of life of Chinese residents, oral health has become a public health issue of great concern. For a long time, the incidence of some common oral diseases, such as dental caries, periodontal disease and mucosal disease, has been increasing year by year. Oral diseases not only affect people's oral health, but also cause some systemic diseases, and oral pathogenic bacteria are the key factors causing these diseases. Other systemic diseases are of crucial importance. [0003] A large number of clinical studies have proved that probiotics play a pivotal role in preventing or reducing oral diseases. Among them, Lactobacillus rhamnosus LGG can not only inhibit the growth of oral pathogenic bacteria in vitro, but also ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K35/747A23L33/135A61P1/02A61P31/02A61P31/04A61K35/74
CPCA23L33/135A23V2002/00A61K35/74A61K35/747A61P1/02A61P31/02A61P31/04A61K2300/00A23V2200/32A23V2250/206
Inventor 张明韩雨婷董园园赵亮
Owner BEIJING TECHNOLOGY AND BUSINESS UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More