Creation and application of sedum plumbizincicola SpHMA2 and SpHMA3 modified heavy-metal hyper-accumulation transgenic engineering rape

A technology of transgenic engineering and sedum with ore, applied in the field of transgenic plants and heavy metal pollution control, can solve the problems of limited tolerance of wild heavy metal enriched plants, special growth environment, heavy metal return, etc., to improve the ability of heavy metal enrichment, genetic Good transformation effect and high expression effect

Inactive Publication Date: 2019-12-03
GUANGDONG KAIYUAN ENVIRONMENT TECH +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The object of the present invention is to provide a method and application of a heavy metal hyper-enrichment transgenic engineering rapeseed that has been transformed with Sedum sedum SpHMA2 and SpHMA3 genes, so as to solve the problem of limited tolerance, slow growth, small biomass, and poor growth in wild heavy metal-enriched plants. The special environment and the return of heavy metals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Creation and application of sedum plumbizincicola SpHMA2 and SpHMA3 modified heavy-metal hyper-accumulation transgenic engineering rape
  • Creation and application of sedum plumbizincicola SpHMA2 and SpHMA3 modified heavy-metal hyper-accumulation transgenic engineering rape
  • Creation and application of sedum plumbizincicola SpHMA2 and SpHMA3 modified heavy-metal hyper-accumulation transgenic engineering rape

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 SphMA2 and SphMA3 double gene cloning

[0046] The seedlings of Sedum sedatus were ground into powder with liquid nitrogen, the RNA was extracted by Trizol method, reverse-transcribed into cDNA using TOYOBO reverse transcription kit, and Primer5 was used to design the cDNA sequence of the SpHMA2 gene provided by NCBI. Downstream primers, and synthetic primers, the nucleotide sequence of the designed primers is:

[0047] Upstream sequence: 5'GAACACGGGGGACTCTAGAGGATCC 3' (as shown in SEQ ID NO: 3);

[0048] Downstream sequence: 5'CATTTATTTCAACCGGTCCGACC 3' (shown in SEQ ID NO:4).

[0049] According to the cDNA sequence of the SpHMA3 gene provided by NCBI, use Primer5 to design its upstream and downstream primers, and synthesize the primers. The nucleotide sequence of the designed primers is:

[0050] Upstream sequence: 5'TTGAAGAGACAATGGATTCTGGAT 3' (as shown in SEQ ID NO: 5);

[0051] Downstream sequence: 5'CATAAAAATAAATTGCGGCGC 3' (shown in SEQ ID NO: 6).

...

Embodiment 2

[0053] The construction of the transformation vector of embodiment 2 heavy metal hyper-enrichment transgenic plant

[0054] The construction of the transformation vector containing 2×CaMV 35S promoter and Hyg selection gene is based on the laboratory’s own pCAMBIA1301 vector, which is obtained after transformation through the following steps:

[0055] Use Primer5 to design the PCR upstream and downstream primers of the CaMV 35S promoter gene, and synthesize the primers. The nucleotide sequence of the designed primers is:

[0056] Upstream sequence: 5'AAGCTTTGAGACTTTTCAACAAAGGGT 3' (as shown in SEQ ID NO: 9);

[0057] Downstream sequence: 5'GGATCCTCAGCGTGTCCTTCCAAATG 3' (shown in SEQ ID NO: 10).

[0058] ① Obtain 2×CaMV 35S promoter: insert the strain containing pCAMBIA1301 vector into LB-Kan medium, and shake the bacteria to extract the plasmid. pCAMBIA1301 was digested with HindⅢ and BamH I, the digested product was electrophoresed on 1% agarose gel, and a small band (about...

Embodiment 3

[0060] Example 3 Overexpression of SphMA2 and SphMA3 Double Genes in Transgenic Plants with Heavy Metal Hyperaccumulation Binary Vector

[0061] Homologous recombination primers were designed according to the two ends of the ORF region of the SpHMA2 gene, and the nucleotide sequence of the designed homologous recombination primers was:

[0062] Upstream sequence (shown as SEQ ID NO: 11):

[0063] 5'AGAGAACACGGGGGACTCTAGAATGGCCTTAGGCGACGAAAAG 3';

[0064] Downstream sequence (shown as SEQ ID NO: 12):

[0065] 5'ACGATCGGGGAAATTCGAGCTCCTACTCCACAACAATCTCGGACAATC 3'.

[0066] Design PCR primers according to the two ends of the ORF region of the SpHMA3 gene, the nucleotide sequence of the designed PCR primers is:

[0067] Upstream sequence (shown as SEQ ID NO:13):

[0068] 5'GAAGATCTATGGATTCTGGATTGGATGAAGTCA 3';

[0069] Downstream sequence (shown as SEQ ID NO: 14):

[0070] 5'GGGTAACCTCAGGCATCCATCTGGCCTTT 3'.

[0071] The 19T vector containing SpHMA2 and the 19T vector conta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a creation method of sedum plumbizincicola SpHMA2 and SpHMA3 double gene modified heavy-metal hyper-accumulation transgenic engineering rape. The creation method comprises thesteps: SpHMA2 and SpHMA3 double genes in sedum plumbizincicola are cloned; a transformation vector containing strong promoters and screening genes is constructed on the basis of a plant expression vector, the SpHMA3 gene is connected to a restriction enzyme cutting site of the transformation vector through a double enzyme digestion method, and the SpHMA2 gene is inserted into the transformation vector through a homologous recombination method to obtain a double-gene over-expression binary vector; and the double-gene over-expression binary vector is transformed into a rape hypocotyledonary axiscutting section through agrobacterium tumefaciens, transgenic seedlings are cultivated, and double-gene pyramiding expression transgenic positive plants are screened. According to the cultivating method, the problems of limited resistance, slow growth, small biomass, special growth environment, heavy metal re-entry and the like of wild heavy-metal accumulated plants can be solved. In addition, the invention further provides application of the heavy-metal hyper-accumulation double gene modified plants obtained in the creation method to soil heavy metal repair.

Description

technical field [0001] The invention belongs to the field of transgenic plants and heavy metal pollution control, and in particular relates to a creation method and application of heavy metal hyper-enrichment transgenic engineering rapeseed with double genes of Sedum sedum SpHMA2 and SpHMA3. Background technique [0002] Heavy metal pollution has become a major environmental problem worldwide. Heavy metal pollution not only threatens the production and development of animals, plants and microorganisms, but also threatens human health and even life through the food chain. Heavy metals that cause soil pollution mainly include As, Cd, Co, Cr, Cu, Hg, etc., which are generally compound pollution of several heavy metals. Heavy metal pollution in heavy metal mining areas and high-speed economic development areas is particularly serious, resulting in many agricultural products in our country being refused to enter the international market due to excessive heavy metals. [0003] Va...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/20B09C1/10
CPCB09C1/105B09C2101/00C12N15/8259C12N15/8271
Inventor 杜鹰陈坤明袁博刘佳兰李永辉白帆魏伟刘捷
Owner GUANGDONG KAIYUAN ENVIRONMENT TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap