Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Creation and application of heavy metal super-enriched genetically-engineered rape genetically modified with Sedum plumbizincicola SpHMA3 gene

A technology of transgenic engineering and sedum with ore, which is applied in the field of heavy metal super-enrichment transgenic engineering rapeseed, can solve the problems of special growth environment, heavy metal reappearance, and small biomass, and achieve good genetic transformation effect, high expression level, biological A large amount of effect

Inactive Publication Date: 2018-06-22
GUANGDONG KAIYUAN ENVIRONMENT TECH
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a creation and application of heavy metal hyper-enrichment transgenic engineering rapeseed with Sedum sedum SpHMA3 gene, to solve the problems of limited tolerance, slow growth, small biomass, special growth environment, and heavy metal return

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Creation and application of heavy metal super-enriched genetically-engineered rape genetically modified with Sedum plumbizincicola SpHMA3 gene
  • Creation and application of heavy metal super-enriched genetically-engineered rape genetically modified with Sedum plumbizincicola SpHMA3 gene
  • Creation and application of heavy metal super-enriched genetically-engineered rape genetically modified with Sedum plumbizincicola SpHMA3 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Cloning of SpHMA3 gene

[0048] The seedlings of Sedum sedatus were ground into powder with liquid nitrogen, the RNA was extracted by Trizol method, reverse-transcribed into cDNA using TOYOBO reverse transcription kit, and Primer5 was used to design the cDNA sequence of the SpHMA3 gene provided by NCBI. Downstream primers, and synthetic primers, the nucleotide sequence of the designed primers is:

[0049] Upstream sequence: 5'TTGAAGCTCAGATCCTCTGGAT 3' (as shown in SEQ ID NO: 2);

[0050] Downstream sequence: 5'CATAAATAGACTTTAGCGGCGC 3' (shown in SEQ ID NO:3).

[0051] After the primers are synthesized, use 1×TE to dissolve, then carry out PCR amplification, using Sedum sedum cDNA as a template, using high-fidelity enzymes It was amplified by GXL Premix, and the amplified product was electrophoresed on 1% agarose gel, and the target band was excised and recovered using a gel recovery kit. The electrophoresis of the amplified product is as follows figure 1 A...

Embodiment 2

[0052] The construction of the transformation vector of embodiment 2 heavy metal hyperaccumulation transgenic plants

[0053] (1) The construction of the transformation vector containing Ubiquitin promoter, Bar screening gene and 3×Flag tag is based on the laboratory’s own pCAMBIA1301-3×Flag vector, which is obtained after transformation through the following steps:

[0054] ① Obtaining the Bar screening gene: the pCAMBIA3301 vector contains the Bar screening gene and the CaMV35S promoter. In this example, the CaMV35S promoter that comes with the pCAMBIA3301 vector is used to activate the Bar screening gene, which can enhance the efficient transformation of the target gene. The CaMV35S promoter core The nucleotide sequence is shown in SEQ ID NO:9. The pCAMBIA3301 vector was cut with Xho I endonuclease, the digested product was subjected to 1% agarose gel electrophoresis, and a small band (608bp) was recovered. Homologous recombination primers were designed according to the pC...

Embodiment 3

[0065] Example 3 Overexpression of the SpHMA3 gene in heavy metal hyperaccumulation transgenic plants binary vector

[0066] Design homologous recombination primers according to the two ends of the ORF region of the SpHMA3 gene, the nucleotide sequence of the designed homologous recombination primers is:

[0067] Upstream sequence (shown as SEQ ID NO:12):

[0068] 5'TTCTGCAGGTCGACTCTAGAGGATCCATGGATTCTGGATTGTGAGATGAA GTC A 3';

[0069] Downstream sequence (shown as SEQ ID NO: 13):

[0070] 5' CTTTGTAGTCGGTACCCGGGGATCCTGGAGGCATCCATCTGGCCTTTCG 3'.

[0071] The 19T vector containing SpHMA3 was used as a template for PCR amplification using high-fidelity enzymes. The PCR product was subjected to electrophoresis on 1% agarose gel, and the target band was recovered for future use. The constructed pUb-3×Flag-Bar transformation vector and p2×CaMV35S-HYG transformation vector were digested with BamHI, respectively, and the digested products were directly gel-recovered for future u...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses creation of heavy metal super-enriched genetically-engineered rape genetically modified with a Sedum plumbizincicola SpHMA3 gene. The creation comprises steps as follows: the SpHMA3 gene in Sedum plumbizincicola is cloned; based on a plant expression vector, a transformation vector containing a strong promoter and a screening gene is established, the SpHMA3 gene is insertedinto the transformation vector with a homologous recombination method, and an overexpression binary vector is obtained; the overexpression binary vector is transformed into a hypocotyl segment of therape by agrobacterium tumefaciens, genetically-modified seedlings are cultured, and genetically-modified positive plants are screened, wherein the transgenic receptor plants are cabbage type rape K407. According to the culture method, the problems of limited endurance, slow growth, small biomass, special growing environment, heavy metal return and the like of a wild heavy metal enriched plant canbe solved. Besides, the invention further provides an application of the heavy metal super-enriched genetically-modified plant obtained through the creation of the heavy metal super-enriched genetically-engineered rape genetically modified with the Sedum plumbizincicola SpHMA3 gene to restoration of heavy metal contaminated soil.

Description

technical field [0001] The invention belongs to the field of transgenic plants and heavy metal pollution control, and specifically relates to the creation and application of heavy metal hyper-enrichment transgenic engineering rapeseed transformed with Sedum sedum SpHMA3 gene. Background technique [0002] Heavy metal pollution has become a major environmental problem worldwide. Heavy metal pollution not only threatens the production and development of animals, plants and microorganisms, but also threatens human health and even life through the food chain. Heavy metals that cause soil pollution mainly include As, Cd, Co, Cr, Cu, Hg, etc., which are generally compound pollution of several heavy metals. [0003] Various countries have paid more and more attention to the research on the ecological effects and prevention of heavy metal pollution, and have explored a variety of treatment technologies. However, traditional physical and chemical methods such as soil solidification,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/29C12N15/66A01H4/00A01H5/00A01H6/20B09C1/10
CPCA01H4/00B09C1/105C07K14/415C12N15/8271
Inventor 罗颜荣陈坤明袁博李永辉吴兆锋魏伟刘捷白帆
Owner GUANGDONG KAIYUAN ENVIRONMENT TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com