Creation and application of heavy metal super-enriched genetically-engineered rape genetically modified with Sedum plumbizincicola SpHMA3 gene
A technology of transgenic engineering and sedum with ore, which is applied in the field of heavy metal super-enrichment transgenic engineering rapeseed, can solve the problems of special growth environment, heavy metal reappearance, and small biomass, and achieve good genetic transformation effect, high expression level, biological A large amount of effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1 Cloning of SpHMA3 gene
[0048] The seedlings of Sedum sedatus were ground into powder with liquid nitrogen, the RNA was extracted by Trizol method, reverse-transcribed into cDNA using TOYOBO reverse transcription kit, and Primer5 was used to design the cDNA sequence of the SpHMA3 gene provided by NCBI. Downstream primers, and synthetic primers, the nucleotide sequence of the designed primers is:
[0049] Upstream sequence: 5'TTGAAGCTCAGATCCTCTGGAT 3' (as shown in SEQ ID NO: 2);
[0050] Downstream sequence: 5'CATAAATAGACTTTAGCGGCGC 3' (shown in SEQ ID NO:3).
[0051] After the primers are synthesized, use 1×TE to dissolve, then carry out PCR amplification, using Sedum sedum cDNA as a template, using high-fidelity enzymes It was amplified by GXL Premix, and the amplified product was electrophoresed on 1% agarose gel, and the target band was excised and recovered using a gel recovery kit. The electrophoresis of the amplified product is as follows figure 1 A...
Embodiment 2
[0052] The construction of the transformation vector of embodiment 2 heavy metal hyperaccumulation transgenic plants
[0053] (1) The construction of the transformation vector containing Ubiquitin promoter, Bar screening gene and 3×Flag tag is based on the laboratory’s own pCAMBIA1301-3×Flag vector, which is obtained after transformation through the following steps:
[0054] ① Obtaining the Bar screening gene: the pCAMBIA3301 vector contains the Bar screening gene and the CaMV35S promoter. In this example, the CaMV35S promoter that comes with the pCAMBIA3301 vector is used to activate the Bar screening gene, which can enhance the efficient transformation of the target gene. The CaMV35S promoter core The nucleotide sequence is shown in SEQ ID NO:9. The pCAMBIA3301 vector was cut with Xho I endonuclease, the digested product was subjected to 1% agarose gel electrophoresis, and a small band (608bp) was recovered. Homologous recombination primers were designed according to the pC...
Embodiment 3
[0065] Example 3 Overexpression of the SpHMA3 gene in heavy metal hyperaccumulation transgenic plants binary vector
[0066] Design homologous recombination primers according to the two ends of the ORF region of the SpHMA3 gene, the nucleotide sequence of the designed homologous recombination primers is:
[0067] Upstream sequence (shown as SEQ ID NO:12):
[0068] 5'TTCTGCAGGTCGACTCTAGAGGATCCATGGATTCTGGATTGTGAGATGAA GTC A 3';
[0069] Downstream sequence (shown as SEQ ID NO: 13):
[0070] 5' CTTTGTAGTCGGTACCCGGGGATCCTGGAGGCATCCATCTGGCCTTTCG 3'.
[0071] The 19T vector containing SpHMA3 was used as a template for PCR amplification using high-fidelity enzymes. The PCR product was subjected to electrophoresis on 1% agarose gel, and the target band was recovered for future use. The constructed pUb-3×Flag-Bar transformation vector and p2×CaMV35S-HYG transformation vector were digested with BamHI, respectively, and the digested products were directly gel-recovered for future u...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap