Creation and application of heavy metal super-enriched genetically-engineered oryza sativa genetically modified with Pteris Vittata PvACR2 gene

A technology of transgenic engineering and heavy metals, applied in genetic engineering, application, plant genetic improvement and other directions, can solve the problems of special growth environment, heavy metal return, limited tolerance, etc., and achieve good genetic transformation effect, high expression, and broad application prospects. Effect

Inactive Publication Date: 2018-06-22
GUANGDONG KAIYUAN ENVIRONMENT TECH
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a heavy metal super-enrichment transgenic engineered rice with PvACR2 gene transgenic and application, so as to solve the problem of limited tolerance, slow growth, small biomass, special growth environment, and heavy metal heavy metals in wild heavy metal-enriched plants. Return and other issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Creation and application of heavy metal super-enriched genetically-engineered oryza sativa genetically modified with Pteris Vittata PvACR2 gene
  • Creation and application of heavy metal super-enriched genetically-engineered oryza sativa genetically modified with Pteris Vittata PvACR2 gene
  • Creation and application of heavy metal super-enriched genetically-engineered oryza sativa genetically modified with Pteris Vittata PvACR2 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 PvACR2 gene cloning

[0048] Use liquid nitrogen to grind centipede grass seedlings into powder, use Trizol method to extract its RNA, use TOYOBO reverse transcription kit to reverse transcribe it into cDNA, and use Primer5 to design its upstream and downstream primers according to the cDNA sequence of PvACR2 gene provided by NCBI , and synthesize primers, the nucleotide sequence of the designed primers is:

[0049] Upstream sequence: 5'TAGAAGACTAGAAGAACG 3' (as shown in SEQ ID NO: 2);

[0050] Downstream sequence: 5'AGCGACGACTAGACGAAAGC 3' (shown in SEQ ID NO: 3). After the primers are synthesized, use 1×TE to dissolve, then carry out PCR amplification, using the cDNA of Centipede grass as a template, using high-fidelity enzymes GXL Premix amplifies it, uses 1% agarose gel to electrophoresis the amplified product, excises the target band (2491bp), and recovers it using a gel recovery kit. The electrophoresis of the amplified product is as follows figure 1...

Embodiment 2

[0051] The construction of the transformation vector of embodiment 2 heavy metal hyperaccumulation transgenic plants

[0052] (1) The construction of the transformation vector containing Ubiquitin promoter, Bar screening gene and 3×Flag tag is based on the laboratory’s own pCAMBIA1301-3×Flag vector, which is obtained after transformation through the following steps:

[0053] ① Obtaining the Bar screening gene: the pCAMBIA3301 vector contains the Bar screening gene and the CaMV35S promoter. In this example, the CaMV35S promoter that comes with the pCAMBIA3301 vector is used to start the Bar screening gene, which can enhance the efficient transformation of the target gene. The CaMV35S promoter core The nucleotide sequence is shown in SEQ ID NO:9. The pCAMBIA3301 vector was cut with Xho I endonuclease, the digested product was subjected to 1% agarose gel electrophoresis, and a small band (608bp) was recovered. Homologous recombination primers were designed according to the pCAMB...

Embodiment 3

[0064] Example 3 PvACR2 gene overexpression binary vector of heavy metal hyperaccumulation transgenic plants

[0065] Design homologous recombination primers according to the two ends of the ORF region of the PvACR2 gene, and the nucleotide sequence of the designed homologous recombination primers is:

[0066] Upstream sequence (shown as SEQ ID NO: 12):

[0067] 5'TTCTGCAGGTCGACTCTAGAGGATCCATGGCCTCGCTTCCATCCCTCT3';

[0068] Downstream sequence (shown as SEQ ID NO: 13):

[0069] 5'TTATTTATGGAGAAACTCGAGTCAAATCTCGGTGACGGGCA 3'.

[0070] The 19T vector containing PvACR2 was used as a template for PCR amplification with high-fidelity enzymes. The PCR product was subjected to electrophoresis on 1% agarose gel, and the target band was recovered for future use. The constructed pUb-3×Flag-Bar transformation vector and p2×CaMV35S-HYG transformation vector were respectively digested with BamH I, and the digested products were directly gel-recovered for future use. Carry out homologo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses creation of heavy metal super-enriched genetically-engineered oryza sativa genetically modified with a Pteris Vittata PvACR2 gene. The creation comprises steps as follows: thePvACR2 gene in Pteris Vittata is cloned; based on a plant expression vector, a transformation vector containing a strong promoter and a screening gene is established, the PvACR2 gene is inserted intothe transformation vector with a homologous recombination method, and an overexpression binary vector is obtained; the overexpression binary vector is transformed into callus tissue of the oryza sativa by agrobacterium tumefaciens, genetically-modified seedlings are cultured, and genetically-modified positive plants are screened, wherein the transgenic receptor plants are the variety of oryza sativa Nipponbare. According to the culture method, the problems of limited endurance, slow growth, small biomass, special growing environment, heavy metal return and the like of a wild heavy metal enriched plant can be solved. Besides, the invention further provides an application of the heavy metal super-enriched genetically-modified plant obtained through the creation of the heavy metal super-enriched genetically-engineered oryza sativa genetically modified with Pteris Vittata PvACR2 gene to restoration of heavy metal contaminated soil.

Description

technical field [0001] The invention belongs to the field of transgenic plants and heavy metal pollution control, and in particular relates to the creation and application of heavy metal hyper-enrichment transgenic engineering rice with transgenic grass PvACR2 gene. Background technique [0002] Heavy metal pollution has become a major environmental problem worldwide. Heavy metal pollution not only threatens the production and development of animals, plants and microorganisms, but also threatens human health and even life through the food chain. Heavy metals that cause soil pollution mainly include As, Cd, Co, Cr, Cu, Hg, etc., which are generally compound pollution of several heavy metals. Heavy metal pollution in heavy metal mining areas and high-speed economic development areas is particularly serious, resulting in many agricultural products in our country being refused to enter the international market due to excessive heavy metals. [0003] Various countries have paid ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/29C12N15/66A01H4/00A01H5/00A01H6/46B09C1/10
CPCA01H4/00B09C1/105C07K14/415C12N15/8271
Inventor 罗颜荣陈坤明袁博李火均吴兆锋魏伟刘捷白帆
Owner GUANGDONG KAIYUAN ENVIRONMENT TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap