Supercharge Your Innovation With Domain-Expert AI Agents!

Co-dominant marker primer capable of distinguishing homozygous genotype and heterozygous genotype of tobacco locus RTSW with resistance to spotted wilt, distinguishing method and application of co-dominant marker primer capable of distinguishing homozygous genotype and heterozygous genotype of tobacco locus RTSW with resistance to spotted wilt

A technology of heterozygous genotypes and co-dominant markers, applied in the field of molecular biology, can solve the problems of inability to distinguish homozygous/heterozygous genotypes of resistance sites, false positives of SCAR markers, and large-scale application of restricted markers. Achieve the effects of obvious difference in belt type, high detection efficiency, and reduced detection cost

Pending Publication Date: 2019-12-10
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, only H. Moon and J.S. Nicholson (2007) have developed the corresponding molecular markers in the world, but the genetic distance between the AFLP marker and the resistance gene is far away, and the linkage is not tight. The developed SCAR markers exist in practical applications. prone to false positives
Moreover, neither marker can distinguish homozygous / heterozygous genotypes at the resistance locus, limiting the large-scale application of these markers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Co-dominant marker primer capable of distinguishing homozygous genotype and heterozygous genotype of tobacco locus RTSW with resistance to spotted wilt, distinguishing method and application of co-dominant marker primer capable of distinguishing homozygous genotype and heterozygous genotype of tobacco locus RTSW with resistance to spotted wilt
  • Co-dominant marker primer capable of distinguishing homozygous genotype and heterozygous genotype of tobacco locus RTSW with resistance to spotted wilt, distinguishing method and application of co-dominant marker primer capable of distinguishing homozygous genotype and heterozygous genotype of tobacco locus RTSW with resistance to spotted wilt
  • Co-dominant marker primer capable of distinguishing homozygous genotype and heterozygous genotype of tobacco locus RTSW with resistance to spotted wilt, distinguishing method and application of co-dominant marker primer capable of distinguishing homozygous genotype and heterozygous genotype of tobacco locus RTSW with resistance to spotted wilt

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0033] The present invention will be further described in detail below in conjunction with the examples.

[0034] Co-dominant molecular marker primers that can distinguish RTSW homozygous heterozygous genotypes of tobacco spotted wilt loci, the molecular marker is the sequence shown in Seq ID No.3 or Seq ID No.4, and the molecular marker can be Amplified with primers consisting of primer 1 and primer 2. The primers consist of two single-stranded DNAs of primer 1 and primer 2.

[0035] The primer 1 sequence is Seq ID No.1:

[0036] RTSW_Marker3_F 5'-TCTGGCTCCGCTACTGTCT-3';

[0037] The primer 2 sequence is Seq ID No.2:

[0038] RTSW_Marker3_R 5'-AGCATTAGGGTTGTAGGATAGGG-3';

[0039] Sequence Seq ID No.3:

[0040] AGCATTAGGGTTGTAGGATAGGGGGTAGCGGAGCTCTTTGCTACTCCGTACCGGATGAGAGGCTAGTCTGACAGGGTTGTGTCCTAGAGTACTAGTAGTTATTGTTGTGTCCAAATTTCTCTTTCACTTTTCATAG TAGCGAGCCTTTCTTACGTGTTACTGCTATTGTTTTTCATCTATTTTCTGGTACTTTTGATTCTGTTA TTATTTCTCAGCTTTCTGCTGTTGGTACTGATATATTGTCTTTTTTGTATGCTTGAGCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a co-dominant marker primer capable of distinguishing homozygous genotype and heterozygous genotype of a tobacco locus RTSW with resistance to spotted wilt, a distinguishing method and application of the co-dominant marker primer capable of distinguishing the homozygous genotype and the heterozygous genotype of the tobacco locus RTSW with resistance to spotted wilt. The primer is composed of two strands of single-stranded DNA of a primer 1 and a primer 2. The co-dominant marker primer can specifically mark and identify tobacco genome DNA to detect the type of an alleleof the RTSW in the tobacco material genome DNA, and not only can whether or not the locus RTSW with resistance to spotted wilt is contained be identified, but also the homozygous genotype and the heterozygous genotype of the tobacco locus RTSW with resistance to spotted wilt can be distinguished, so that the co-dominant marker primer is reliable and convenient to use, compared with prior markers with resistance to spotted wilt, the co-dominant marker primer has the advantages that the co-dominant marker primer is in close linkage with the target gene RTSW, the accuracy is high, the cost is low, the detection efficiency is high, and the like, the efficiency of screening a variety with the gene RTSW with resistance to spotted wilt of tobacco can be greatly improved, a breeding cycle of the disease-resistant tobacco variety is greatly shortened, and the breeding efficiency is improved.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, in particular to co-dominant marker primers capable of distinguishing RTSW homozygous heterozygous genotypes of RTSW resistance sites in tobacco and its location, cloning or selection of RTSW resistance genes in tobacco Application in spotted wilt varieties. Background technique [0002] Tobacco spotted wilt is a disease of tobacco caused by the infection of Orthotospovirus. This genus is a plant virus with the widest range of hosts and the most serious occurrence. Its representative American species, Tomato Spotted Wilt Virus (TSWV), has posed a greater threat to tobacco leaf production in Yunnan tobacco-growing areas in my country. . According to the test results of samples collected from various places (states, cities) and counties in Yunnan in recent years, TSWV is distributed on tobacco in Yunnan province and tends to expand and intensify. What is even more worrying is that none ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156Y02A50/30
Inventor 黄昌军刘勇
Owner YUNNAN ACAD OF TOBACCO AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More