Co-dominant marker primer capable of distinguishing homozygous genotype and heterozygous genotype of tobacco locus RTSW with resistance to spotted wilt, distinguishing method and application of co-dominant marker primer capable of distinguishing homozygous genotype and heterozygous genotype of tobacco locus RTSW with resistance to spotted wilt
A technology of heterozygous genotypes and co-dominant markers, applied in the field of molecular biology, can solve the problems of inability to distinguish homozygous/heterozygous genotypes of resistance sites, false positives of SCAR markers, and large-scale application of restricted markers. Achieve the effects of obvious difference in belt type, high detection efficiency, and reduced detection cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0033] The present invention will be further described in detail below in conjunction with the examples.
[0034] Co-dominant molecular marker primers that can distinguish RTSW homozygous heterozygous genotypes of tobacco spotted wilt loci, the molecular marker is the sequence shown in Seq ID No.3 or Seq ID No.4, and the molecular marker can be Amplified with primers consisting of primer 1 and primer 2. The primers consist of two single-stranded DNAs of primer 1 and primer 2.
[0035] The primer 1 sequence is Seq ID No.1:
[0036] RTSW_Marker3_F 5'-TCTGGCTCCGCTACTGTCT-3';
[0037] The primer 2 sequence is Seq ID No.2:
[0038] RTSW_Marker3_R 5'-AGCATTAGGGTTGTAGGATAGGG-3';
[0039] Sequence Seq ID No.3:
[0040] AGCATTAGGGTTGTAGGATAGGGGGTAGCGGAGCTCTTTGCTACTCCGTACCGGATGAGAGGCTAGTCTGACAGGGTTGTGTCCTAGAGTACTAGTAGTTATTGTTGTGTCCAAATTTCTCTTTCACTTTTCATAG TAGCGAGCCTTTCTTACGTGTTACTGCTATTGTTTTTCATCTATTTTCTGGTACTTTTGATTCTGTTA TTATTTCTCAGCTTTCTGCTGTTGGTACTGATATATTGTCTTTTTTGTATGCTTGAGCC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



