Optically controlled gene transcription inhibition system and method, and construction method for optically controlled gene transcription inhibition system

A technology of gene transcription and construction method, which is applied in the field of light-controlled gene transcription inhibition system and inhibition and construction, can solve the problems of affecting the quality of life of patients, heavy economic burden, delaying the best time for the treatment of fundus lesions, etc. sexual effect

Inactive Publication Date: 2019-12-31
TIANJIN UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The treatment process needs to be repeated many times, but the effect is not good, and the damage cannot be effectively reversed
This current treatment situation not only creates a heavy financial burden for the patient's family, but also easily delays the best time for the treatment of fundus lesions, leading to irreversible damage or even blindness, which seriously affects the quality of life of the patient.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Optically controlled gene transcription inhibition system and method, and construction method for optically controlled gene transcription inhibition system
  • Optically controlled gene transcription inhibition system and method, and construction method for optically controlled gene transcription inhibition system
  • Optically controlled gene transcription inhibition system and method, and construction method for optically controlled gene transcription inhibition system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Construction of gene-targeting sgRNA plasmid expression vector: Take the design of guideRNA targeting VEGF factor as an example:

[0078] The sgRNA expression vector construction sequence is SEQ.No.1, as follows:

[0079] gcgctccccaccggcccgtg

[0080] (1) First determine the 20bp VEGF target sequence (the genome sequence should be 20bp+NGG);

[0081] (2) Since the starting base of U6humanpromoter transcription needs to be G, if the first 20bp is G, skip this part; add an additional G before 20bp to form a G+20bp sequence;

[0082] (3) Add caccg before 20bp or G+20bp5' to form cacc-G+20bp sequence, which is Forward sequence (directly synthesized by the company);

[0083] (4) Perform reverse complementation of 20bp or G+20bp, and add aaac before 5', then it is a Reverse sequence (directly synthesized by the company);

[0084] (5) The forward and reverse bases (molar concentration: 100 μM) of the synthesized sgRNA are annealed to make base pairing and form a double-strand...

Embodiment 2

[0090] To verify the efficiency of the interaction between light-regulated proteins cib1 and cry2, take 293T cells as an example:

[0091] Perform cell transfection experiments with cib1-GEP expression plasmids and cry2-mcherry plasmids with fluorescent tags: plant cells in confocal small dishes one day in advance, and culture 1ug of DNA and 2ul of transfection reagent with 50ul of serum-free respectively base dilution. Stand at room temperature for 5 minutes; add the transfection reagent dilution to the DNA dilution, mix well, and let stand at room temperature for 15 minutes; add the transfection complex to the culture container containing cells and complete medium, and incubate for 4-6 hours Afterwards, the medium was replaced, and after 48 hours of culture and expression, the interaction of photoregulated proteins was observed in real time under the action of a 488nm laser using a confocal microscope. Experimental results such as figure 1 As shown, the results show that a...

Embodiment 3

[0093] (1) Perform cell transfection experiments with sgRNA, dCas9-cib1, and cry2-HDAC plasmid expression vectors: plant cells in a 12-well plate one day in advance, and culture 1.2ug of DNA and 4ul of transfection reagent with 25ul of serum-free base dilution. Stand at room temperature for 5 minutes; add the transfection reagent dilution to the DNA dilution, mix well, and let stand at room temperature for 15 minutes; add the transfection complex to the culture container containing cells and complete medium, and incubate for 4-6 hours Afterwards, the medium was replaced, and the cultivation was continued for 24-48h.

[0094] (2) Set up the control group (only transfected with dCas9-cib1, cry2-HDAC plasmid expression vector) and the experimental group (transfected with sgRNA, dCas9-cib1, cry2-HDAC plasmid) to set up the dark group and the light group respectively, and the light group is set at 488nm After 24 hours of light with a frequency of 1 Hz and a power of 0.75 w, qPCR w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an optically controlled gene transcription inhibition system and method, and a construction method for the optically controlled gene transcription inhibition system. A CRISPR (Clustered regularly interspaced short palindromic repeats) system is mainly used to design genes which are targeted by different sgRNAs (small guide Ribonucleic Acid) and have different purposes. An optically controlled transcription inhibition system is introduced, blue light dependence responsive proteins cibl and cry2 mutually act under different illumination conditions to drive HDAC (histone deacetylase) to indirectly act on a target gene, the HDAC is combined to a target gene site, histone is subjected to deacetylation, and gene transcription is inhibited so as to realize optically controlled gene transcription inhibition. A "CRISPR gene targeting-optogenetic gene regulation and control" technology is used for realizing the accurate targeting of a VEGF (vascular endothelial growth factor) and a receptor gene. Meanwhile, an optogenetic regulation and control technology is used for realizing the dynamic real-time controllable regulation of the VEGF and a receptor molecule accordingto individual differences.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a light-controlled gene transcription inhibition system and an inhibition and construction method. Background technique [0002] With the expansion of population aging, the problem of geriatric diseases has become prominent. Among them, common fundus diseases (such as macular degeneration, fundus hemorrhage, diabetic retinopathy, etc.) often lead to severe vision loss or even blindness, seriously affecting the quality of life of middle-aged and elderly people. However, in the process of clinical treatment of the above-mentioned fundus diseases, there are still insurmountable defects such as: 1) the therapeutic effect is "not durable", 2) the therapeutic effect is "easy to get out of control", 3) the therapeutic effect is "uncoordinated", etc., resulting in poor clinical therapeutic effect good. [0003] At present, using anti-VEGF method to treat neovascular fundus lesio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/66C12N5/10
CPCC12N15/85C07K14/475C12N2310/20
Inventor王汉杰李佳桦常津郝亚锋潘惠卓
OwnerTIANJIN UNIV