CtDNA library construction and sequencing data analysis methods for simultaneously detecting common mutations of various liver cancers

A construction method and a technology for sequencing libraries, which are applied in DNA preparation, recombinant DNA technology, biochemical equipment and methods, etc., and can solve problems such as time-consuming, inability to detect unknown mutations, and easy contamination.

Active Publication Date: 2020-01-10
CANCER INST & HOSPITAL CHINESE ACADEMY OF MEDICAL SCI +1
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

ctDNA-based detection methods include 1) PCR-based hotspot mutation detection method, usually detects one or several hotspot mutations or known mutations, cannot detect complex mutations such as gene fusion, and cannot detect unknown mutations
2) Capture / next-generation sequencing method: It can detect positional mutations in many genes, including complex mutations, but capture kits are generally expensive, complicated to operate, and time-consuming
In addition, in ctDNA-related clinical testing or research, it is often necessary to compare the advantages and disadvantages of multiple techniques, which requires several times the normal blood volume, which is usually unacceptable to patients.
2) Regardless of the PCR method or the capture method, the noise mutations generated during the amplification process will seriously interfere with the detection of low-frequency mutations in ctDNA, resulting in false positive results and misleading the diagnosis and treatment of patients
3) The ctDNA mutation content is low, and contamination is prone to occur during the operation, resulting in false positive results
There is currently no simple, low-cost, and reliable solution for the systematic detection of ctDNA mutations in liver cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CtDNA library construction and sequencing data analysis methods for simultaneously detecting common mutations of various liver cancers
  • CtDNA library construction and sequencing data analysis methods for simultaneously detecting common mutations of various liver cancers
  • CtDNA library construction and sequencing data analysis methods for simultaneously detecting common mutations of various liver cancers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0080] Embodiment 1, the construction of MC library

[0081] 1. Blunt end repair and A treatment of cfDNA molecules

[0082] Take 10-45ng cfDNA, configure the reaction system as shown in Table 1, and then perform end repair and 3’ end A treatment in the PCR instrument according to the procedures in Table 2 to obtain the reaction product (stored at 4°C).

[0083] Table 1 reaction system

[0084] Element volume cfDNA 50μl End Repair&A-Tailing Buffer(KAPA KK8505) 7μl End Repair&A-Tailing Enzyme Mix(KAPA KK8505) 3μl total capacity 60μl

[0085] Table 2 Reaction program

[0086] temperature time 20℃ 30min 65℃ 30min

[0087] 2. Connection between cfDNA and adapter

[0088] Configure the reaction system according to Table 3, react at 20°C for 15 minutes, and obtain the ligation product (stored at 4°C).

[0089] Table 3 reaction system

[0090] Element volume The reaction product obtained in...

Embodiment 2

[0116] Example 2, RaceSeq enriches the target region and constructs a sequencing library

[0117] Such as figure 2 As shown, the MC library was amplified by two rounds of PCR using primers designed for the relevant regions of high-frequency mutation genes of liver cancer in my country (TP53, CTNNB1, AXIN1, TERT) and for HBV integration hotspot regions, and fixed primers. The product is the sequencing library.

[0118] figure 2 Among them, a is the upstream primer of the first round of library amplification, b is the upstream primer of the second round of library amplification, c is the downstream primer library of the first round of library amplification, which is used for the enrichment of specific target sequences, and d is the second round of library amplification Amplify the downstream primer library for the enrichment of specific target sequences, e is the index primer, used to add the index sequence.

[0119] 1. Take 300ng of the MC library prepared in Example 1, div...

Embodiment 3

[0160] Example 3, capture and sequencing of MC library

[0161] Such as image 3 As shown, the Agilent sureselect XT targeted capture kit (Agilent5190-8646) can be used to capture the MC library of Example 1 (refer to the kit instructions, and it is also compatible with other brands of capture reagents) to replace the primers in the last step of PCR amplification For the following primers:

[0162] Upstream primer (5'-3'): AATGATACGGCGACCACCGAGATTCTACACTCTTTCCCTACAC GACGCTCTTCC GATCT (Sequence 345)( image 3 In "a"), the underlined part is the same as the primer MC_F, which is used to amplify the library, and the rest is the fixed sequence required for sequencing on the Illumina sequencing platform.

[0163] Downstream primer (5'-3'): CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 346)********GTCTC GTGGGCTCGGAGATGTGTATAA (Sequence 347)( image 3 In "b"), the underlined part is the same as the primer MC_R, which is used to amplify the library. ********** is the position of the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses ctDNA library construction and sequencing data analysis methods for simultaneously detecting common mutations of various liver cancers. The library construction method and thesequencing data analysis method have the following advantages: firstly, various mutation forms of liver cancers are simultaneously detected under the condition that capture is not needed; secondly, the methods are suitable for efficient capturing in an ultra-small target area; thirdly, the library can support 10 to 20 times of detection; fourthly, the DNA barcode is connected to an initial ctDNA molecule during the library construction process and the flow is analyzed by cooperating with a biological information analysis process to realize high-specificity detection of ctDNA low-frequency mutation; and fifthly, the library can be used for PCR hot spot detection and capture method sequencing at the same time, the false positive mutation can be filtered effectively by using the added DNA barcode to realize duplex-based high-specificity sequencing. The methods have the important clinical significance for early screening, disease tracking, curative effect evaluation, prognosis prediction and the like of liver cancers.

Description

technical field [0001] The invention relates to a ctDNA library construction and sequencing data analysis method for simultaneously detecting multiple common mutations of liver cancer. Background technique [0002] ctDNA (circulating tumor DNA), that is, circulating tumor DNA, refers to the tumor DNA that exists in blood, cerebrospinal fluid and other body fluids and frees outside the cells. ctDNA is usually mixed with free DNA from normal cells in the blood, which is called cfDNA (cellfree DNA increases spaces). By detecting ctDNA mutations, it can guide targeted drug use, treatment monitoring, early screening of cancer, and so on. ctDNA-based detection methods include 1) PCR-based hotspot mutation detection method, which usually detects one or several hotspot mutations or known mutations, but cannot detect complex mutations such as gene fusions, and cannot detect unknown mutations. 2) Capture / next-generation sequencing method: It can detect positional mutations in many g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6806C12Q1/6886
CPCC12Q1/6806C12Q1/6886C12Q2600/156C12Q2525/191C12Q2531/113C12N15/1093C12Q2525/155C12Q2535/122C12Q2563/179C12Q1/6827C12Q1/6855C12N15/1096
Inventor焦宇辰曲春枫王沛陈坤王宇婷宋欠欠王思振阎海
OwnerCANCER INST & HOSPITAL CHINESE ACADEMY OF MEDICAL SCI