Unlock instant, AI-driven research and patent intelligence for your innovation.

Construction method of dyskinesia phenotypic GTP cyclohydrolase (GTPCH) enzyme defective mouse model

A technology of motor dysfunction and construction method, which is applied in the field of construction of mouse models of motor dysfunction phenotype GTPCH enzyme deficiency, can solve problems such as unavailable disease mechanism and treatment research, reduce the number of animal identification and use, and improve R&D efficiency and the effect of prolonging the average life expectancy

Active Publication Date: 2020-02-11
GUANGZHOU WOMEN AND CHILDRENS MEDICAL CENTER
View PDF9 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Recently, scientists in Cambridge, UK reported Gch1 knockout mice. However, the mice were embryonic lethal and could not be used for research on the disease mechanism and treatment of DRD caused by GTPCH enzyme deficiency.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of dyskinesia phenotypic GTP cyclohydrolase (GTPCH) enzyme defective mouse model
  • Construction method of dyskinesia phenotypic GTP cyclohydrolase (GTPCH) enzyme defective mouse model
  • Construction method of dyskinesia phenotypic GTP cyclohydrolase (GTPCH) enzyme defective mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] This example provides a method for constructing a mouse model of motor dysfunction phenotype GTPCH enzyme deficiency disease. For the construction steps, see figure 1 , including the following steps:

[0054] 1. Establishment of Gch1p.Leu108Arg point mutation heterozygous mice based on classical B6 strain (C57BL / 6) mice by CRISPR / Cas9 technology

[0055] 1.1 CRISPR / Cas9 Targeting System

[0056] Human GCH1 p.Leu117 is located at the entrance of the binding pocket of the catalytic substrate GTP of the GTPCH enzyme. Mutation to arginine will cause steric hindrance and affect the binding of the substrate GTP to the enzyme. Mouse p.Leu108 is highly conserved with human p.Leu117. Based on this, a synthetic guide sgRNA (SEQ ID No.1) and an oligonucleotide donor (ssDNA) for homologous recombination repair were designed.

[0057] sgRNA (SEQ ID No.1): CATCAAATATAGCATCATTCAGG

[0058] ssDNA (SEQ ID No. 2):

[0059] AAAATATTTACTATCCTTCAGTATTTAACCAATTTTGTGTTTTCCCGGTTCCAGATGTAC...

Embodiment 2

[0108] This example provides a method for constructing a mouse model of motor dysfunction phenotype GTPCH enzyme deficiency disease. The construction steps refer to Example 1, and the changes relative to Example 1 are "2. F1 generation heterozygous mutant mice" In the step, wild-type mice of 129Sv strain were used instead of wild-type mice of DBA / 2 strain. The results are shown in Table 3, Figure 7 , Figure 8 .

[0109] table 3

[0110]

[0111] According to Table 3, it can be seen that, using the construction method of this example, GCH1 homozygous mutant mice almost completely avoid the problem of embryonic lethality. according to Figure 7 It can be seen that, adopting 129Sv strain wild-type mice to cross with Gch1 missense mutant heterozygous mice under the C57BL / 6 strain background and then selfing the F1 generation heterozygotes to obtain homozygous mutant mice can also improve the homozygous mutant mice. (Gch1 KI / KI rats) birth rate and survival time. Althou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction method of a dyskinesia phenotypic GTP cyclohydrolase (GTPCH) enzyme defective mouse model. The construction method comprises the steps that (1) Gch1 p.Leu108Argheterozygous mutant mice are obtained, leucine codon at 108 position of Gch1 genes of the heterozygous mutant mice is mutated into arginine codon; (2) the heterozygous mutant mice are hybridizedwith wild-type mice of other strains, and F1-generation heterozygous mutant mice are screened; and (3) the F1-generation heterozygous mutant mice are inbred, and F2-generation homozygote mutant mice are screened. According to the construction method, the deadly problem of GTPCH enzyme defective embryos in the development process can be avoided, and the birth rate of the homozygote mutant mice canreach or close to the expected proportion of Mendel; and at the same time, the mice with different genetic background are hybridized, the survival of F2-generation mice after birth can further be improved, and the average survival period is prolonged.

Description

technical field [0001] The invention relates to the field of animal model construction, in particular to a method for constructing a motor dysfunction phenotype GTPCH enzyme deficiency mouse model. Background technique [0002] Dopa-responsive dystonia (Dopa-Responsive Dystonia, DRD) is a group of monogenic genetic diseases of dopamine synthesis disorder listed in the "First List of Rare Diseases". The main clinical manifestations are abnormal muscle tone, motor dysfunction, language dysfunction, depression, etc. The application of levodopa treatment can partially improve the clinical symptoms and signs, so it is called DRD. Many enzymes and coenzymes are involved in the biosynthesis of dopamine and 5-hydroxytryptamine. Mutations in genes involved in encoding these enzymes and coenzymes may lead to abnormal coding enzymes, leading to DRD. Among them, the GCH1 gene was the first to be discovered and the most reported DRD pathogenic gene. [0003] The GCH1 gene is located on...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/90C12N15/85A01K67/027
CPCA01K67/0276A01K2217/075A01K2227/105A01K2267/0306C12N9/78C12N15/8509C12N15/907C12Y305/04016
Inventor 蒋晓玲刘丽郑晓宁刘华圳
Owner GUANGZHOU WOMEN AND CHILDRENS MEDICAL CENTER