Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of wide window single base editing gene and its application and breeding method

A single-base, editing technology, applied in the fields of biotechnology and plant genetic engineering, can solve the problems of rare, low single-base editing efficiency, limited editing window, etc., to achieve excellent genetic resources, significant research significance and The effect of social value and high editing efficiency

Active Publication Date: 2022-04-12
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the currently used single-base editing system still has certain defects, such as the low efficiency of single-base editing in plants and the limited editing window.
[0006] However, editors with high editing efficiency and wide windows are very difficult to obtain, and are often unavailable. Currently, there are few reports on editors with high editing efficiency and wide windows.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of wide window single base editing gene and its application and breeding method
  • A kind of wide window single base editing gene and its application and breeding method
  • A kind of wide window single base editing gene and its application and breeding method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1——CP1249-OsSpCas9-eABE gene synthesis

[0046] The gene of the present application is named CP1249-OsSpCas9-eABE, and its sequence is shown in SEQ ID NO:1.

[0047] The gene sequence of CP1249-OsSpCas9-eABE was sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis, then PCR amplified and transformed into Escherichia coli XL-blue. It should be noted that the CP1249-OsSpCas9-eABE obtained by the inventors of the present application during the research and development process was obtained through various cross-combination adjustments of gene sequences and fragments. The specific acquisition process is a technical secret and will not be described in detail. Those skilled in the art can also directly synthesize according to the disclosure content of the present invention, which does not affect the realization of the present invention, but the cost will increase.

Embodiment 2

[0049] Example 2—Construction of plant targeting vector containing CP1249-OsSpCas9-eABE gene

[0050] From the Escherichia coli XL-blue containing the CP1249-OsSpCas9-eABE vector above, use the Axygen plasmid extraction kit to extract the plasmid, digest it with NotI / SacI, and recover the CP1249-OsSpCas9-eABE fragment. At the same time, NotI / SacI enzyme was used to linearize pHUN900, recover pHUN900, and connect the above CP1249-OsSpCas9-eABE fragment and pHUN900 fragment with T4 ligase (purchased from TaKaRa Company) to obtain the plant expression vector pHUN CP1249-OsSpCas9- eABE( figure 1 ), named pHUN411 CP1249-eABE.

[0051] Nucleotide sequence AAGGAAAAAGATTCCGTCGG of exon 1 in selected rice PDS gene (Os03g0184000) AGG , (the underlined part is the PAM sequence of the 5'NGG-3' structure), as the targeting site. The target site sequence was fused to pHUN411 CP1249-eABE to form pHUN41 CP1249-eABE-PDS. The plant expression vector was transformed into Agrobacterium tumef...

Embodiment 3

[0053] Example 3—Genetic transformation of rice using PHUN CP1249-eABE-PDS as a targeting vector and acquisition of mutants.

[0054] 1. Induction and pre-culture of mature embryo callus

[0055] The mature seeds of Nipponbare rice are dehulled, and the seeds with normal appearance and cleanness without mildew are selected, shaken for 90 sec with 70% alcohol, and the alcohol is poured off; Add 1 drop of Tween20) solution to 100 milliliters to wash the seeds, and shake on a shaker for 45 minutes (180 r / min). Pour off the sodium hypochlorite, wash with sterile water 5-10 times until there is no smell of sodium hypochlorite, finally add sterile water, soak overnight at 30°C. Use a scalpel to separate the embryos along the aleurone layer, put the scutellum up on the induction medium (see Table 1 for ingredients), 12 embryos / dish, and culture in the dark at 30°C to induce callus.

[0056] Two weeks later, spherical, rough, light yellow secondary callus appeared, and pre-cultivati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a single base editing system OsSpCas9-eCDA and its application and breeding method. Through a large number of experiments, the present invention tries to modify SpCas9-ABE in different ways, and finally successfully obtains a CP1249-OsSpCas9-eABE editor with high single-base editing efficiency and wide window. And the present invention also provides an expression cassette and an expression vector comprising the CP1249-OsSpCas9-eABE gene, and the application of the expression cassette and the expression vector in rice gene editing. The present invention utilizes the designed CP1249-OsSpCas9-eABE gene to construct a plant expression vector, and then constructs a rice targeting vector, which causes a single base substitution of a rice-specific gene site after being introduced into rice cells, especially to realize the mutation from A / T base to C / G. Using this editor to edit rice genes can edit more mutants, obtain more random mutations or obtain mutant libraries with more mutations.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and plant genetic engineering. Specifically, the present invention relates to the application of an efficient single base editing window widening system CP1249-OsSpCas9-eABE in rice gene targeting. Background technique [0002] Current gene editing technologies (ZFN, TALEN, CRISPR / Cas9) rely on DNA double-strand breaks at targeted sites, thereby activating DNA repair mechanisms to achieve gene correction. Therefore, the gene editing technology based on double-strand breaks is not only prone to DNA fragment insertion and deletion, but also may produce off-target effects, which will eventually affect the function of the target gene. The emergence of single base editing technology effectively overcomes this problem. [0003] Single-base gene editing technology (base editors, BEs) refers to gene editing technology that can cause a single base replacement at a specific site in the genome. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82A01H4/00A01H5/00A01H6/46
CPCC12N15/113C12N15/8218A01H4/00C12N2310/20
Inventor 许蓉芳李娟秦瑞英刘小双单调风廖圣祥魏鹏程
Owner RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com