Recombinant pichia pastoris engineering bacterium containing high-copy-number humanized lysozyme gene and application thereof
A Pichia pastoris, copy number technology, applied to recombinant Pichia pastoris engineering bacteria containing a high copy number human lysozyme gene and its application field, can solve problems such as unfavorable large-scale production and application, high cost, small scale, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1 Artificial synthesis of human lysozyme gene hlyz derived from Homo sapiens and construction of pPIC9K-hlyz plasmid
[0046] According to the NCBI database GenBank Protein ID P61626 Homo sapiens-derived human lysozyme amino acid sequence (SEQ ID NO. 1), and Wuxi Huada Qinglan Biotechnology Co., Ltd. carried out gene synthesis, and cloned the gene between EcoRI and NotI of pPIC9K to obtain recombinant plasmid pPIC9K-hlyz, such as figure 1 shown. Transform it into E.coli DH5α strain to obtain E.coli DH5α(pPIC9K-hlyz) recombinant strain.
Embodiment 2
[0047] Example 2 Constructing Pichia pastoris recombinant bacteria expressing human lysozyme in secreted form
[0048] After the linearized pPIC9K-hlyz plasmid was transformed into Pichia pastoris GS115, the resistant strains were screened on a high-concentration G418 plate, and then the strains with high production of human lysozyme were screened on a lysozyme plate, and finally obtained by a Erlenmeyer flask shake flask experiment The Pichia pastoris recombinant strain that secretes and expresses human source lysozyme, the specific embodiment is as follows:
[0049] ① Linearize the pPIC9K-hlyz plasmid. The strain E.coli DH5α (pPIC9K-hlyz) was inoculated into LB medium containing 100 μg / mL ampicillin, cultured overnight at 37°C, and the pPIC9K-hlyz plasmid was extracted using a plasmid extraction kit; the restriction enzyme SacI was used to Cut the plasmid pPIC9K-hlyz to make it linearized, and perform gel recovery on the digested product, and purify the linearized plasmid a...
Embodiment 3
[0076] Example 3 Construction of recombinant plasmid pPICZα-hlyzV with multiple copies of human lysozyme
[0077] Based on the pPICZαA plasmid, after 5 steps of assembly, the recombinant plasmid pPICZα-hlyzV containing 5 copies of the reading frame of the human lysozyme gene was constructed, such as figure 2 As shown, the specific operation method is as follows:
[0078] ①Clone hlyz-TT between the EcoRI and BsmBI of pPICZαA to obtain the recombinant plasmid pPICZα-hlyzTT, the specific operation is as follows: first extract the pPICZαA plasmid, perform double enzyme digestion with EcoRI and BsmBI, and gel recovery and purification; use primer hlyzTT-1 -F: gagaaaagagaggctgaagctgaattcaaggtctttgagagatgcga and hlyzTT-1-R: CTCGAGGTACCGATCCGAGACGACTTCTCACTTAATCTTCTGTAC, using the plasmid pPIC9k-hlyz as the DNA template, using the high-efficiency enzyme Phanta MaxSuper-Fidelity DNA Polymer from Vazyme Biotech Co., Ltd. Perform PCR amplification to obtain the hlyz-TT fragment, gel re...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com