A method for constructing an aav vector specifically expressing Cre in the ca2 region of mouse hippocampus and its application
What is AI technical title?
AI technical title is built by PatSnap AI team. It summarizes the technical point description of the patent document.
A mouse and vector technology applied in the field of genetic engineering
Active Publication Date: 2022-04-22
SOUTHEAST UNIV
View PDF0 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
The Cre recombinase carrier driven by the Map3k15 promoter constructed by the present invention, combined with the application of DIO-EGFP, DIO-chemical elements and DIO-optogenetic elements, solves the problem of effectively marking and tracing neurons in the CA2 region and effectively controlling the activity of nerve cells The problem
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0034] Example 1: Cloning of Map3k15 promoter fragment
[0035] (1) DNA extracted from mouse brain (Qiagen DNeasy Blood and Tissue Kit, Catalog No.69504) was used as a template to amplify fragments of different lengths at the 5'-end of Map3k15 (Takara PrimerSTAR HS DNApolymerase, Catalog No. R010A).
[0036] A 3639bp fragment at the 5'-end of Map3k15 was amplified, which also included a part of Exon1 369bp downstream of the start codon. Use primer pairs:
[0037]Map3kpromo-F2:aggttggctgcaaactcact;
[0038] Map3kpromo-R: atcgtagaaggcatcgagcac;
[0039] Simultaneously amplify the 2293bp Map3k15 5'-terminal promoter fragment in the same way, using the primer pair:
[0040] Map3kpromo-F: gctggaactagggaaggatttc;
[0041] Map3kpromo-R: atcgtagaaggcatcgagcac;
[0042] At the same time, the 499bp Map3k15 5'-terminal promoter fragment was amplified in the same way, and the primer pair was used:
[0043] Map3kpromo-F3:ggaggaagtcaggggagggaggaaa;
[0044] Map3kpromo-R3: gcggggctgg...
Embodiment 2
[0047] Embodiment 2: Determination of Map3k15 startup efficiency
[0048] The three Map3k15 5'-end amplified fragments were subcloned into pGL4.0 plasmid respectively, using a non-ligase-dependent multi-fragment one-step cloning technique (Vazyme, ClonExpress MultiS One Step Cloning Kit, C113-02) and the following primer pairs :
[0077] Embodiment 3: Construction of rAAV-Map3k15-Cre plasmid vector
[0078] Using the rAAV-EF1α-NLS-Cre-WPRE-pA (Wuhan Privy Brain Science and Technology Co., Ltd., #143) plasmid as the vector backbone, the 499bp fragment of Map3k15 was cloned into MluI and SalI two enzymecutting sites. Use primer pairs:
[0081] get as figure 2 The indicated plasmid vector was sent to Wuhan Privy Science and Technology Co., Ltd. for virus packaging.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention provides a construction method and application of an AAV virus vector capable of specifically expressing Cre recombinase in the CA2 region of mouse hippocampus. The invention cuts out the partial promoter region of mouse hippocampus CA2 specific expression gene Map3k15 and connects it with Cre recombinase, and clones it into the pAAV vector without initial promoter. The AAV vector with the Map3k15 promoter linked to the Cre recombinase constructed by the present invention can effectively specifically overexpress the Cre recombinase in the CA2 region of the mouse hippocampus to achieve specific regulation of neuron activity in the CA2 region, and establishes a small gene that does not depend on the Cre transgene. The mouse CA2 neuron tracing and regulation system provides an effective tool for studying the function of the CA2 region, and provides a basis for the subsequent study of the molecular mechanism of CA2 function.
Description
technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a construction method and application of an AAV vector specifically expressing CRE in the CA2 region of mouse hippocampus. Background technique [0002] The harm to society and family caused by neurological diseases such as cognitive impairment, autism and senile dementia is attracting more and more attention from society and individuals. At present, our understanding of the nervous system is still in the exploratory stage, and our understanding of the functions and neural circuits of various brain regions and different nerve cells in mammals is very limited. [0003] Many studies have known that the hippocampus is a brain region that has an important impact on cognition, learning, memory, and social interaction. In recent years, the CA2 region of the hippocampus has been confirmed to be related to social memory, but its molecular mechanism is still unclear. In order...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.