A type III procollagen N-terminal peptide nanobody, its coding sequence and its use
A nanobody and sequence technology, applied in the field of biomedicine or biopharmaceuticals, can solve the problems of high cost, low specificity and robustness of detection methods, and high minimum detection limit.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1: Preparation of Nanobody Phage Display Library
[0028] Collect peripheral blood from dromedary camels, centrifuge at 2000rp for 5min, collect peripheral blood cells (PMBC), add Trizol to extract total RNA, use total RNA as template, oligo(dT)20 and random primer (N9) as primers, prepare cDNA by RT-PCR One strand, use the first strand of cDNA as a template, and perform two rounds of PCR amplification with the following primers;
[0029] Primers for the first round of PCR amplification:
[0030] Upstream primer: 5'-GTCCTGGCTGCTCTTCTACAAGG-3'
[0031] Downstream primer: 5'-GGTACGTGCTGTTGAACTGTTCC-3'
[0032] Primers for the second round of PCR amplification:
[0033] VHHFR1: 5'-ACTGGCCCAGGCGGCCGATGTGCAGCTGCAGGAGTCTGGAGGAGG-3'
[0034] VHHFR4: 5'-ACTGGCCGGCCTGGCCTGAGGAGACGGTGACCAGGGTC-3'
[0035]Camel VHH fragments of 400-500bp were amplified by two rounds of PCR, and the amplified VHH fragments were connected to the pComb3X phage display vector, and E.coliX...
Embodiment 2
[0036] Example 2: Screening and prokaryotic expression of PIIINP nanobody
[0037] 100 μg / mL PIIINP was coated on a 96-well plate, washed with PBS, added to the nanobody phage display library (1011 phage particles), and the enrichment index was monitored by phage ELISA analysis. After three rounds of panning, the collected phage particles were infected with E.coli XL-2 Blue, IPTG-induced expression, the fermentation supernatant was taken, analyzed by HRP-coupled anti-HA-monoclonal antibody ELISA, and a high-affinity nanobody strain was obtained; the plasmid was further transformed into E.coli TOP10', IPTG-induced prokaryotic expression, after Strep tag II-mediated Streptactin Beads 4FF affinity chromatography, a highly expressed PIIINP nanobody was obtained as figure 2 shown.
Embodiment 3
[0038] Example 3: Expression and specificity identification of nanobodies
[0039] 1. Extract the plasmid pComb3X-PIIINP-Nb of the Nanobody gene from Escherichia coli respectively, and sequence the above plasmid using primer TTTACACTTTATGCTTCCGGCT, and obtain a Nanobody amino acid residue sequence (SEQID 8) and its corresponding encoding Nanobody DNA sequence (SEQ ID 9);
[0040] 2. Using the plasmid pComb3X-PIIINP-Nb as a template, the DNA sequence (SEQ ID 9) of the PIIINP nanobody (SEQ ID 8) was subcloned into pET22b, and E.coli BL21 (DE3) was used as the expression host to express recombinantly containing HA-tagged nanobody; after IPTG-induced prokaryotic expression, a highly expressed HA-tagged PIIINP nanobody was obtained by Streptag II-mediated Streptactin Beads 4FF affinity chromatography;
[0041] 3. Using bovine serum albumin BSA as a control, evaluate the specificity of the PIIINP nanobody, use HRP-coupled anti-HA monoclonal antibody as the detection antibody, detec...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More