Super-large plasmid construction kit, super-large plasmid construction method and application thereof

A kit and plasmid technology, applied in the field of synthetic biology, can solve the problems of weak assembly ability of large fragments of DNA, difficult in vivo assembly of super-large plasmids, and low assembly success rate, so as to enhance in vivo assembly ability, improve in vivo recombination efficiency, and improve The effect of the synthesis success rate

Pending Publication Date: 2020-04-14
SUZHOU HONGXUN BIOTECH CO LTD
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the Gateway technology needs to construct an entry vector, which is time-consuming and expensive; the Golden Gate technology relies on type II restriction endonuclease and ligase, and is not suitable for the synthesis of sequences with the above enzymes, and needs to analyze the fragment sequence in advance Then assemble; while the traditional Gibson assembly technology is less efficient when performing multi-fragment assembly, especially for fragments with larger fragments, the assembly success rate is very low
[0004] The yeast in vivo assembly method is limited by the growth rate of yeast, which takes a long time; Escherichia coli grows fast, but its ability to assemble large fragments of DNA is weak, and it is difficult to complete the in vivo assembly of super large plasmids

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Super-large plasmid construction kit, super-large plasmid construction method and application thereof
  • Super-large plasmid construction kit, super-large plasmid construction method and application thereof
  • Super-large plasmid construction kit, super-large plasmid construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] The in vitro assembly of embodiment 1 ultra-large plasmid

[0071] The construction process of super large plasmids is as follows: figure 1 As shown, in this example, the in vitro assembly of the ultra-large plasmid was first carried out.

[0072] (1) Splitting of large fragments of DNA

[0073] Sequence analysis software was used to analyze the 32kb large fragment DNA, split into four fragments of 8kb in length, and then continue to split the 8kb fragment into 2kb initial fragments, and design homology arms between adjacent initial fragments ( The homology arm is the leftmost 60bp sequence and the rightmost 60bp sequence of the initial fragment) for subsequent homologous recombination;

[0074] (2) Splitting of the initial segment

[0075] Use sequence analysis software to split the initial fragments into DNA fragments to be assembled F n , n=30, F n It is a long primer sequence separated by forward and reverse directions, and the adjacent fragment contains a 20bp...

Embodiment 2

[0091] Example 2 Preparation of linearized lambda phage Red recombination system

[0092] The λ bacteriophage Red recombination system (SEQ ID NO: 1) was digested, and the system is shown in Table 5, and the linearized enzyme digestion product was recovered and purified to obtain the linearized λ phage Red recombination system.

[0093] SEQ ID NO: 1:

[0094]aagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgtttttttgggaattcgagctctaaggaggttataaaaaatggatattaatactgaaactgagatcaagcaaaagcattcactaaccccctttcctgttttcctaatcagcccggcatttcgcgggcgatattttcacagctatttcaggagttcagccatgaacgcttattacattcaggatcgtcttgaggctcagagctgggcgcgtcactaccagcagctcgcccgtgaagagaaagaggcagaactggcagacgacatggaaaaaggcctgccccagcacctgtttgaatcgctatgcatcgatcatttgcaacgccacggggccagcaaaaaatcc...

Embodiment 3

[0097] Example 3 Preparation of Escherichia coli Electrotransfer Competent Cells

[0098] (1) Pick fresh EPI300 colonies and inoculate them into 4 mL of LB medium, and culture overnight at 37°C under a well-ventilated condition;

[0099] (2) Dilute 1 mL of overnight cultured cells into 300 mL of LB medium, and culture at 37°C for 2-3 hours in a well-ventilated condition until the OD600 is 0.5;

[0100] (3) Collect cells by centrifugation at 3,500rpm for 10min;

[0101] (4) Wash the cells twice with ice-cold sterile washing buffer, and centrifuge at 3,500 rpm for 10 min;

[0102] (5) The cell suspension was centrifuged at 3,500 rpm for 10 minutes, and the supernatant was poured out immediately after the centrifugation;

[0103] (6) Wash the cells twice with a solution containing 10% ultrapure glycerol and 90% ultrapure double distilled water, and centrifuge at 4,000 rpm for 10 min;

[0104] (7) Resuspend the cells in washing buffer (approximately 2 mL), aliquot and freeze at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a super-large plasmid construction kit, a super-large plasmid construction method and application of the super-large plasmid construction kit. The kit comprises a DNA fragment Fn to be assembled and a vector, wherein the vector includes an intermediate vector and / or an assembly vector. The kit further comprises a lambda bacteriophage Red recombination system. By adopting a mode of combining in-vitro assembly and in-vivo assembly, large-fragment DNA and the assembly vector are firstly assembled in vitro by adopting a recombinase system, and then the in-vitro assembly product and the lambda phage Red recombinant system are simultaneously transformed into escherichia coli for in-vivo assembly. The constructed kit combines the advantages of in-vitro assembly and in-vivoassembly, the in-vivo assembly capacity of escherichia coli is enhanced by adopting the lambda phage Red recombination system, the synthesis rate of super-large plasmids is increased, and the synthesis success rate of the super-large plasmids is remarkably increased.

Description

technical field [0001] The invention belongs to the technical field of synthetic biology, and relates to a super large plasmid construction kit, a super large plasmid construction method and applications thereof. Background technique [0002] In recent years, synthetic biology has developed rapidly and has been widely used in the fields of biomedicine, energy and new materials. Ultra-large plasmids can be used to synthesize structural units of the genome, serve technologies such as gene editing, protein expression, and antibody expression, and are helpful for research on metabolic pathways, gene functions, protein functions, and immunotherapy. However, there are many difficulties in the synthesis of super-large plasmids, especially those above 40kb. Although scientists have proposed a variety of methods for the synthesis of super-large plasmids, there is generally a problem of low efficiency. This requires improvements and breakthroughs in the synthesis and assembly of supe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/66
CPCC12N15/70C12N15/66
Inventor朱佑民杨平孙健柳伟强刘敏祥严成丽邢妍婧赵一凡
OwnerSUZHOU HONGXUN BIOTECH CO LTD