Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Protein nanoparticles carrying antitumor peptide and preparation method and application of protein nanoparticles

A nanoparticle and anti-tumor technology, which is applied in the field of protein nanoparticles carrying anti-tumor peptides and its preparation, can solve the problems of ineffective internalization and achieve good tumor treatment effects

Active Publication Date: 2020-05-08
BEIHUA UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to its hydrophilicity, it cannot be effectively internalized into tumor cells, so it must be coupled with a receptor or ligand in the cell-penetrating part, and enter the target cell through a receptor-independent and dependent mechanism in order to exert its potential. pro-apoptotic properties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein nanoparticles carrying antitumor peptide and preparation method and application of protein nanoparticles
  • Protein nanoparticles carrying antitumor peptide and preparation method and application of protein nanoparticles
  • Protein nanoparticles carrying antitumor peptide and preparation method and application of protein nanoparticles

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0047] In order to further illustrate the technical effect of the present invention, the present invention will be described in detail below through embodiments.

[0048] The present invention is based on the pro-apoptotic property of pro-apoptotic peptide (KLAK) and the property that small heat shock protein (HSP16.5) can self-assemble into nano-cages under physiological conditions (0°C-70°C, pH 5-11). , Design and develop a nano-cage drug-carrying system loaded with KLAK peptide. The specific amino acid sequence of the designed HSP-KLAK nanoparticles is as follows: GPLGLAGKLAKLAKKLAKLAK.

[0049] Construction of pET25b-HSP16.5-KLAK expression vector:

[0050] Synthesize DNA fragments corresponding to KLAK:

[0051] Upstream primer:

[0052] 5'CCCAAGCTTGACCATTAGGATTAGCAGGAAAACTGGCGAAACTGGCGAAAAAACTGGCGAAACTGGCGAAAGCGGCCGCACTCGAGCGG3';

[0053] Downstream primers:

[0054] 5'CCGCTCGAGTGCGGCCGCTTTCGCCAGTTTCGCCAGTTTTTTCGCCAGTTTCGCCAGTTTTCCTGCTAATCCTAATGGTCCAAGCTTGGG 3';

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biomedicines and in particular relates to protein nanoparticles carrying an antitumor peptide and a preparation method and application of the protein nanoparticles. The preparation method comprises the following steps: according to gene sequences of a pET25b(+)-HSP16.5 expression vector, synthesizing a single stranded DNA (deoxyribonucleic acid) sequence corresponding to an apoptosis-promoting peptide, namely KLAK peptide, performing annealing treatment, performing HindIII and XhoI double-digestion on the product and the vector, performing gel recycling on the digestion product, connecting the KLAK sequence with the vector, transforming the connection product into a competence of DH5a escherichia coli, picking a monoclonal bacterial colony, performing overnight bacterium shaking, extracting a plasmid, and performing sequencing; and transforming a pET25b(+)-HSP-KLAK plasmid with correct sequencing into a competence of BL21 escherichia coli, amplifying culture, performing ultrasonic bacterium crushing so as to obtain a corresponding crude product, performing purification, and performing dialysis, concentration and freeze-drying, so as to obtain an HSP-KLAK protein. The heat shock protein nanoparticles carrying the antitumor peptide, which are provided by the invention, can be rapidly taken in by tumor cells, after being released inlysosome, a targeting mitochondrion plays a role of tumor killing, the protein of the medicine carrier self can be rapidly degraded by cells, and thus a good tumor treatment effect can be achieved.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to a protein nanoparticle carrying an antitumor peptide and a preparation method and application thereof. Background technique [0002] Cancer, also known as malignant tumor, is a frequently-occurring disease caused by multiple factors, multiple gene mutations, and multiple stages of development. The serious toxicity and side effects of traditional chemotherapy drugs during clinical use and the multi-drug resistance of tumor cells are seriously limited. Their application in tumor therapy. [0003] Polypeptide is a small "protein" composed of a small amount of amino acids (10-100), which has the advantages of small molecular weight, easy modification, clear structure, clear mechanism of action, and activity close to that of protein. It combines the advantages of chemical drugs and protein drugs. Therefore, It has become one of the hot spots in the current research and developmen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K9/51A61K38/16A61K47/42A61P35/00C07K19/00C07K1/14C12N15/62C12N15/70C12N15/66
CPCA61K9/5169A61K9/0019A61K38/16A61P35/00C07K7/08C07K14/47C12N15/70C12N15/66C07K2319/00
Inventor 关新刚夏薇王冬梅
Owner BEIHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products