Protein nanoparticles carrying antitumor peptide and preparation method and application of protein nanoparticles
A nanoparticle and anti-tumor technology, which is applied in the field of protein nanoparticles carrying anti-tumor peptides and its preparation, can solve the problems of ineffective internalization and achieve good tumor treatment effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0047] In order to further illustrate the technical effect of the present invention, the present invention will be described in detail below through embodiments.
[0048] The present invention is based on the pro-apoptotic property of pro-apoptotic peptide (KLAK) and the property that small heat shock protein (HSP16.5) can self-assemble into nano-cages under physiological conditions (0°C-70°C, pH 5-11). , Design and develop a nano-cage drug-carrying system loaded with KLAK peptide. The specific amino acid sequence of the designed HSP-KLAK nanoparticles is as follows: GPLGLAGKLAKLAKKLAKLAK.
[0049] Construction of pET25b-HSP16.5-KLAK expression vector:
[0050] Synthesize DNA fragments corresponding to KLAK:
[0051] Upstream primer:
[0052] 5'CCCAAGCTTGACCATTAGGATTAGCAGGAAAACTGGCGAAACTGGCGAAAAAACTGGCGAAACTGGCGAAAGCGGCCGCACTCGAGCGG3';
[0053] Downstream primers:
[0054] 5'CCGCTCGAGTGCGGCCGCTTTCGCCAGTTTCGCCAGTTTTTTCGCCAGTTTCGCCAGTTTTCCTGCTAATCCTAATGGTCCAAGCTTGGG 3';
[...
PUM
| Property | Measurement | Unit |
|---|---|---|
| particle diameter | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


