Electrochemical nucleic acid detection method based on DNA (deoxyribonucleic acid) walking and rolling circle amplification signal magnification
A detection method and nucleic acid technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of insufficient sensitivity, high detection cost, inconvenient operation, etc., and achieve low detection cost, high sensitivity, and easy operation Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0030] Embodiment: Taking GCTAGAGATTTTCCACACTGACT as the target nucleic acid as an example, the DNA sequence involved in this embodiment is shown in Table 1:
[0031] Table 1 DNA sequence
[0032]
[0033] The detection principle of this case is as follows figure 1 Shown: First, silver nanoparticles were synthesized as electrochemical signal probes, which can be labeled on DNA chains modified with amino groups at the ends. Then two kinds of DNA tetrahedrons (DNA walker, DNA track) were assembled respectively, and fixed on the surface of the gold electrode according to a certain concentration ratio. This kind of tetrahedral DNA not only improves the molecular recognition efficiency of DNA walking, but also avoids spacer molecules, such as mercaptohexanol, which are generally required for electrode surface modification. The amino group marked on the DNA track can react with the silver nanoparticles through the silver-ammonia bond, so that the silver nanoparticles are positi...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com