Supercharge Your Innovation With Domain-Expert AI Agents!

Bacillus amyloliquefaciens CGMCC No.17844 and application thereof

A technology of Bacillus amyloliquefaciens and Bacillus, applied in the fields of Bacillus amyloliquefaciens, Bacillus amyloliquefaciens and its application, microbial agents, compound agents, fertilizers and prevention and control of root rot, which can solve secondary pollution and the effect of physical means To achieve the effect of promoting strawberry growth, improving yield and quality, and solving the problems of fruit and vegetable preservation and long-term storage

Active Publication Date: 2020-05-26
SINOCHEM AGRI LINYI R&D CENT CO LTD
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, physical means are less effective, and chemical means are likely to cause secondary pollution. Biological means are environmentally friendly and highly targeted for disease resistance, so they are excellent means to prevent and control strawberry root rot.
[0003] However, biological treatments for root rot need further improvement

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus amyloliquefaciens CGMCC No.17844 and application thereof
  • Bacillus amyloliquefaciens CGMCC No.17844 and application thereof
  • Bacillus amyloliquefaciens CGMCC No.17844 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0043] The preparation conditions of Trichoderma viride and Aspergillus terreus inoculum were similar. In at least some embodiments of the present invention, Trichoderma viride and Aspergillus terreus can be fermented in PDA liquid culture liquid respectively, then fermented culture liquid is inoculated on the second solid fermentation medium, obtain Aspergillus terreus and Aspergillus viride respectively of fermentation products. Wherein, the available second solid fermentation medium includes: 2-5 parts by weight of wheat bran, 1-5 parts by weight of cornstarch, 0.5-3 parts by weight of rice dregs, 0.5-3 parts by weight of millet, 0.3-3 parts by weight of millet, 1.5 parts by weight of straw residue and water, wherein the water content in the solid fermentation medium is 55%-65%. In some preferred embodiments, the second solid fermentation medium comprises: 2 parts by weight of wheat bran, 1.5 parts by weight of cornstarch, 1 part by weight of rice broken residue, 1 part by...

Embodiment 1

[0048] Example 1 Isolation and screening of Bacillus amyloliquefaciens (numbering CGMCC No.17844)

[0049] (1) By isolating the diseased strain of strawberry root rot, isolate and obtain the pathogenic bacterium of strawberry root rot-clad-shaped Polychaete spp., and its colony morphology is as follows figure 1 As shown, determined by ITS sequence, and MEGA7.0 for phylogenetic tree analysis as figure 2 Shown (this clavate Discosporum is abbreviated as ZH-G01), the result shows that the bacterial strain that isolates is clavate Discosporum.

[0050]The ITS sequence of Discosporum clavate ZH-G01:

[0051] TACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCA TTAAACTCTTGTTATTTTATGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAA CAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATG TGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTAT TCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGG AATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTC TGAGCGTAGTAATTTTT...

Embodiment 2

[0057] The identification of embodiment 2 bacillus amyloliquefaciens

[0058] Embodiment 2 further identifies the microbial strain obtained in Example 1, and this microbial strain is identified as Bacillus amyloliquefaciens. Including: Obtain the sequence of the microbial strain through 16S rRNA sequence determination, and use MEGA7.0 to do phylogenetic tree analysis, such as Figure 5 shown (in Figure 5 The strain is abbreviated as J4 in this paper). The results showed that the isolated strain was Bacillus amyloliquefaciens.

[0059] The DNA sequence of the strain encoding 16S rRNA is:

[0060] ACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGGACAGATGGGAGCT TGCTCCCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGC CTGTAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTG TTTGAACCGCATGGTTCAGACATAAAAGGTGGCTTCGGCTACCACTTACA GATGGACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGG CGACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAG ACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATG GACGAAAGTCTGACGGAGCAACGCCGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of microorganisms, and relates to bacillus amyloliquefaciens and an application thereof. The bacillus amyloliquefaciens is preserved in the China General Microbiological Culture Collection Center, and a preservation number of the bacillus amyloliquefaciens is CGMCC No. 17844. The bacillus amyloliquefaciens can be prepared into a microbial agent, can also be prepared into a composite microbial agent together with other microbial agents, can also be prepared into a fertilizer, and is used for preventing and treating root rot and increasing the crop yield.

Description

technical field [0001] The present invention relates to the field of microorganisms and fertilizers, in particular to Bacillus amyloliquefaciens and its application, specifically to a strain of Bacillus amyloliquefaciens (preservation number CGMCC No. 17844), microbial agents, composite bacterial agents, fertilizers and methods for preventing and controlling root rot method. Background technique [0002] Strawberry is easy to cultivate, bears fruit in the same year, has good taste, high yield, and good economic benefits. It has an important economic position in the domestic and international markets. However, with the expansion of strawberry planting area and many cultivars, the phenomenon of continuous cropping and disease aggravation year by year has also occurred, and long-term application of insufficient or incompletely decomposed livestock and poultry manure as base fertilizer brings in pathogenic bacteria and affects soil nutrient balance. . At the same time, farmers...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C05G3/60C12R1/07C12R1/885C12R1/66
CPCC05D3/00C05G3/00C12N1/20C12N1/205C12R2001/07C05D9/00C05F3/00
Inventor 朱其立冷伟锋戴黎杜延全
Owner SINOCHEM AGRI LINYI R&D CENT CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com