Method for knocking in terminator to achieve transcription factor knockout by using gene editing technology

A technology of gene editing and transcription elements, applied in the biological field, can solve problems such as difficulty in picking out single clones, experimental deviations, and low efficiency

Pending Publication Date: 2020-06-02
SHANGHAI CHANGHAI HOSPITAL
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But this still has low efficiency, and it is more difficult to pick a single clone. Moreover, if the gene sequence where the non-coding RNA is located is an enhancer or other key element, its loss will inevitably lead to serious experimental bias
[0006] At present, there is no report on a gene knockout method based on gene editing technology that is more efficient, has a wider range of applications, and can be applied to non-coding RNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking in terminator to achieve transcription factor knockout by using gene editing technology
  • Method for knocking in terminator to achieve transcription factor knockout by using gene editing technology
  • Method for knocking in terminator to achieve transcription factor knockout by using gene editing technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0113] Example 1: CRISPR-Cas9 technology knocks in terminator to realize knockout of long non-coding RNA TTTY15

[0114] 1) Using molecular cloning technology to construct a vector containing the transcription termination sequence (terminator) TK_PA_terminator and containing the Neomycin resistance gene, and expressing EGFP.

[0115] The specific sequence of TK_PA_terminator is shown in SEQ ID NO.1.

[0116] 2) The human genome in mammals was selected as the design intervention target, TTTY15 was used as the non-coding RNA to be knocked out, and the gRNA was designed to recognize: gRNA-TTTY15, and its recognition site sequence is as follows, TCAGGCAATCCAGCCGCCC GGG (SEQ ID NO.2), wherein GGG is a PAM sequence.

[0117] 3) The gRNA-TTTY15 and gRNA-plug expression vectors were constructed respectively, and the corresponding expression elements were constructed into the lentiviral backbone vector PLKO-bsd (these two plasmids can be packaged into lentiviruses). The Cas9 express...

Embodiment 2

[0137] Example 2: CRISPR-Cas9 technology knocks in terminator to realize knockout of protein coding gene MMS22L

[0138] 1) Using molecular cloning technology to construct a vector containing the transcription termination sequence (terminator) TK_PA_terminator and containing the Neomycin resistance gene, and expressing EGFP.

[0139] 2) The human genome in mammals was selected as the design intervention target, MMS22L was used as the protein-coding gene to be knocked out, and the gRNA was designed to recognize: gRNA-MMS22L, and its recognition site sequence is as follows, GCTTAAGGGCTCCGCTGCAG AGG (SEQ ID NO.3), wherein AGG is a PAM sequence.

[0140] 3) The expression vectors of gRNA-MMS22L and gRNA-plug were respectively constructed, and the corresponding expression elements were constructed into the lentiviral backbone vector PLKO-bsd (these two plasmids can be packaged into lentiviruses). The Cas9 expression vector is a commercially available plasmid Cas9 expression vector ...

Embodiment 3

[0151] Example 3: CRISPR-Cas9 technology knocks in the terminator to realize the knockout of microRNA miR-155

[0152] 1) A vector containing the transcription termination sequence (terminator) TK_PA_terminator (flanked with TTTT sequence) and the Hygromycin B resistance gene was constructed using molecular cloning technology.

[0153] 2) The human genome in mammals is selected as the design intervention target, miR-155 is used as the microRNA to be knocked out, and the gRNA is designed to recognize: gRNA-miR-155, and its recognition site sequence is as follows, GTTAATGCTA ATCGTGATAG GGG (SEQ ID NO.4), wherein GGG is a PAM sequence.

[0154] 3) The expression vectors of gRNA-miR-155 and gRNA-plug were respectively constructed, and the corresponding expression elements were constructed into the lentiviral backbone vector PLKO-bsd (these two plasmids can be packaged into lentivirus). The Cas9 expression vector is a commercially available plasmid Cas9 expression vector was purc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for knocking in a terminator to achieve efficient knockout of a transcription factor (including protein editing genes, non-encoding genes, and the like) by using a gene editing technology. Specifically, DNA (deoxyribonucleic acid) break is caused behind a transcription start site (TSS) of a gene to be knocked out by using a gene editing technology, meanwhile, a DNA donor with a transcription termination sequence (terminator) is introduced into cells, the doner does not comprise a target gene homologous sequence, the DNA donor is also linearized by using the gene editing technology, then after the terminator is knocked into a TSS of a target gene through a non-homologous repairing way, endogenous transcription of the target gene is terminated ahead of time,and thus knockout of the target gene is achieved. The method is wide in application scope, and all transcription facts can be knocked out by the method. The doner DNA has universality, has high efficiency, and in addition, has resistance genes, and the method is high in efficiency and has certain practical value.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a more efficient and wider application range (including non-coding RNA) gene knockout method based on gene editing technology. Background technique [0002] Gene knockout (knockout) is a kind of genetic engineering technology, which makes specific genes lose their function by changing the genetic material of organisms at the genome level. , so as to infer the function of the gene. It is an important tool for functional genome research, and also provides strong technical support for the treatment of some diseases and the improvement of tool organisms. [0003] Traditional gene knockout is a molecular biology technology based on embryonic stem cell technology and gene homologous recombination technology, and its efficiency is relatively low. Gene editing has had as much impact on biomedical research as PCR did 30 years ago. The emergence of gene editing technology provides us with a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/90
CPCC12N15/902
Inventor蒋俊锋黎力肖广安王越孙颖浩
OwnerSHANGHAI CHANGHAI HOSPITAL