Primer pair for detecting novel coronavirus SARS-CoV-2, probe, composition and kit and application thereof
A coronavirus and detection reagent technology, applied in the field of primer pairs for the detection of the new coronavirus SARS-CoV-2, can solve the problems of expensive instruments, difficulty in moving forward the epidemic prevention and control threshold, and inability of patients to cause pathogens, so as to meet the needs of rapid diagnosis and treatment. The effect of monitoring the whole process, controlling the epidemic, gaining time, and shortening the testing time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Embodiment 1, be used to detect the design of the fluorescent RT-RAA primer of novel coronavirus SARS-CoV-2, probe
[0050] For the specific conserved region of the new coronavirus SARS-CoV-2 as the target region, specific primers and fluorescent RAA probes were designed. The sequences are:
[0051] Forward primer, such as the nucleotide sequence shown in SEQ ID No.: 1 in the sequence listing:
[0052] 5'-CCAGTGCTCAAAGGAGTCAAATTACATTAC-3'
[0053] Reverse primer, such as the nucleotide sequence shown in SEQ ID No.: 2 in the sequence listing:
[0054] 5'- AAAACAGCAAGAAGTGCAACGCCAACAATA -3'
[0055] Oligonucleotide probes, such as the nucleotide sequence shown in SEQ ID No.: 3 in the sequence listing:
[0056] 5'-GGTGAAATCAAGGATGCTACTCCTTCAGA[BHQ-dT][THF][FAM-dT]TGTTCGCGCTACTG-3';
[0057] Wherein: FAM-dT represents a thymidine deoxynucleotide carrying a fluorescein group FAM (6-Carboxyfluorescein);
[0058] THF represents a tetrahydrofuran (tetrahydrofuran) linker; ...
Embodiment 2
[0060] Embodiment 2. Establishment of a fluorescent RT-RAA method for detecting novel coronavirus SARS-CoV-2
[0061] (1) Fluorescence RT-RAA reaction
[0062] 1) Extraction of sample RNA: The sample RNA can be extracted by using the viral RNA nucleic acid extraction kit from Kaiser Bioengineering Co., Ltd., according to the kit instructions.
[0063] 2) Using the forward primer, reverse primer and probe designed in Example 1, and the RT-RAA reaction kit (this example specifically uses the RT-RAA basic kit of Jiangsu Qitian Gene Biotechnology Co., Ltd.), Using the sample RNA to be detected prepared in step 1) of this embodiment as a template, the amplification reaction is carried out, wherein the reaction system is as follows:
[0064] 25 μl RT-RAA reaction buffer (provided by RT-RAA basic kit of Jiangsu Qitian Gene Biotechnology Co., Ltd.);
[0065] 2.1 μL each of the forward primer and reverse primer (10 μM) designed in Example 1;
[0066] 0.6 μL of the probe designed in ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



