Application of RSPH14 gene, application of RSPH14 inhibitor, nucleic acid molecule, construct and composition
A nucleic acid molecule and inhibitor technology, applied in the field of biomedical research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0104] Example 1 Preparation of RNAi lentivirus against human RSPH14 gene
[0105] 1. Screening for effective siRNA targets against the human RSPH14 gene
[0106] Retrieve RSPH14 (NM_014433) gene information from Genbank; design effective siRNA targets for RSPH14 gene. Table 1-1 lists the screened effective siRNA target sequences against RSPH14 gene.
[0107] Table 1-1 is targeted at the siRNA target sequence of human RSPH14 gene
[0108] SEQ ID NO TargetSeq(5'-3') 1 GATCATCAGCAAAGGTCTGAT
[0109] 2. Preparation of lentiviral vector
[0110] Aiming at the siRNA target (taking SEQ ID NO: 1 as an example), synthesize a double-stranded DNA Oligo sequence (Table 1-2) with Age I and EcoR I restriction endonuclease at both ends; use AgeI and EcoR I restriction endonuclease Act on the pGCSIL-GFP vector (provided by Shanghai Jikai Gene Chemical Technology Co., Ltd.) to make it linear, and identify the digested fragments by agarose gel electrophoresis.
[011...
Embodiment 2
[0130] Embodiment 2 detects the silencing efficiency of gene
[0131] Human lung cancer A549 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, A549:10), an appropriate amount of the lentivirus prepared in Example 1 was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells were collected.
[0132] a) Real-time fluorescent quantitative RT-PCR
[0133] Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV instruction manual of Promega Company, RNA was reverse-transcribed to obtain cDNA (see Table 2-1 for the reverse transcription reaction system, react at 42°C for 1 hour, and then bathe in a water bath at 70°C for 10 minutes to inactivat...
Embodiment 3
[0168] Example 3 Detection of proliferation ability of tumor cells infected with RSPH14-siRNA lentivirus
[0169] a) Celigo experiment
[0170] Human lung cancer A549 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, A549:10), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells of each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 3000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the plat...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



