Supercharge Your Innovation With Domain-Expert AI Agents!

Application of RSPH14 gene, application of RSPH14 inhibitor, nucleic acid molecule, construct and composition

A nucleic acid molecule and inhibitor technology, applied in the field of biomedical research

Pending Publication Date: 2020-06-30
SICHUAN CANCER HOSPITAL
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, rs4443100SNP near RTDR1 may be related to serum parathyroid hormone level
[0003] At present, there is no relevant report on the use of RSPH14 gene in the treatment of lung cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of RSPH14 gene, application of RSPH14 inhibitor, nucleic acid molecule, construct and composition
  • Application of RSPH14 gene, application of RSPH14 inhibitor, nucleic acid molecule, construct and composition
  • Application of RSPH14 gene, application of RSPH14 inhibitor, nucleic acid molecule, construct and composition

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0104] Example 1 Preparation of RNAi lentivirus against human RSPH14 gene

[0105] 1. Screening for effective siRNA targets against the human RSPH14 gene

[0106] Retrieve RSPH14 (NM_014433) gene information from Genbank; design effective siRNA targets for RSPH14 gene. Table 1-1 lists the screened effective siRNA target sequences against RSPH14 gene.

[0107] Table 1-1 is targeted at the siRNA target sequence of human RSPH14 gene

[0108] SEQ ID NO TargetSeq(5'-3') 1 GATCATCAGCAAAGGTCTGAT

[0109] 2. Preparation of lentiviral vector

[0110] Aiming at the siRNA target (taking SEQ ID NO: 1 as an example), synthesize a double-stranded DNA Oligo sequence (Table 1-2) with Age I and EcoR I restriction endonuclease at both ends; use AgeI and EcoR I restriction endonuclease Act on the pGCSIL-GFP vector (provided by Shanghai Jikai Gene Chemical Technology Co., Ltd.) to make it linear, and identify the digested fragments by agarose gel electrophoresis.

[011...

Embodiment 2

[0130] Embodiment 2 detects the silencing efficiency of gene

[0131] Human lung cancer A549 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, A549:10), an appropriate amount of the lentivirus prepared in Example 1 was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells were collected.

[0132] a) Real-time fluorescent quantitative RT-PCR

[0133] Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV instruction manual of Promega Company, RNA was reverse-transcribed to obtain cDNA (see Table 2-1 for the reverse transcription reaction system, react at 42°C for 1 hour, and then bathe in a water bath at 70°C for 10 minutes to inactivat...

Embodiment 3

[0168] Example 3 Detection of proliferation ability of tumor cells infected with RSPH14-siRNA lentivirus

[0169] a) Celigo experiment

[0170] Human lung cancer A549 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, A549:10), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells of each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 3000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the plat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biological medicine research, and specifically relates to an application of a human RSPH14 gene as a target in preparation of a lung cancer treatment drug or a lung cancer diagnosis drug. According to the invention, results of wide and deep research find that effective inhibition to proliferation of lung cancer cells, promotion of apoptosis and effective control to the growth process of the lung cancer can be realized after the expression of the human RSPH14 gene is down-regulated by adopting an RNAi method. The siRNA or the nucleic acid construct and theslow virus containing the siRNA sequence provided by the invention can specifically inhibit the proliferation rate of the lung cancer cells, influence the cycle of the lung cancer cells, promote apoptosis of the lung cancer cells and inhibit the growth of the lung cancer, so the lung cancer is treated, and a new direction is opened up for treatment of the lung cancer.

Description

technical field [0001] The invention belongs to the field of biomedical research, and specifically relates to the use of human RSPH14 gene and related products. Background technique [0002] The RSPH14 gene encodes a protein of unknown function that has a slight resemblance to yeast vacuolar proteins. This gene is located in the region of chromosomal deletion in rhabdomyosarcoma of children's brain, kidney and soft tissue, etc., but the mutation of this gene has nothing to do with the disease (Isolation of genes from the rhabdoid tumor deletion region in chromosome band22q11.2. Zhou J, et al. Gene, 2000 Jan 4. PMID 10607907). Multiple junction-related probe amplification and capillary electrophoresis were performed on the surgical samples of 354 patients with congenital heart disease. Among them, 11.3% of the patients had deletions or amplifications to varying degrees in the 22q11.2 region of the chromosome group, and the RSPH14 gene was Located in this region, it indicate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12N15/113C12N15/867A61K31/713A61P35/00
CPCC12Q1/6886C12N15/1135C12N15/86A61K31/713A61P35/00C12Q2600/158C12N2740/15043Y02A50/30
Inventor 何金涛马可彭俊荣昊张华川
Owner SICHUAN CANCER HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More