Unlock instant, AI-driven research and patent intelligence for your innovation.

Triangular mesh RNA scaffold for intracellular immobilization of recombinant protein and its construction method and application

A recombinant protein and triangular technology, applied in the direction of recombinant DNA technology, DNA/RNA fragments, biochemical equipment and methods, etc., can solve the problem of low stability of RNA scaffolds, achieve economic value and broad application prospects, and improve enzymatic reactions Efficiency and productivity improvement effects

Active Publication Date: 2022-06-07
SHANDONG UNIV +1
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, the RNA scaffold is mainly a linear structure, the stability of the RNA scaffold is not high, and the number of recombinant protein molecules anchored by the RNA scaffold is small. In order to increase the structure density of the RNA scaffold and the density of the anchored protein molecules to improve the reaction rate, a triangle Planar mesh RNA scaffolds to enhance catalytic performance in recombinant cells emerge as a necessity
After searching, there are no reports on the patents related to the construction of triangular planar mesh RNA scaffolds

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Triangular mesh RNA scaffold for intracellular immobilization of recombinant protein and its construction method and application
  • Triangular mesh RNA scaffold for intracellular immobilization of recombinant protein and its construction method and application
  • Triangular mesh RNA scaffold for intracellular immobilization of recombinant protein and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Construction of RNA scaffold recombinant plasmid

[0038] 1) The entrusted company to synthesize a DNA sequence as shown in SEQ ID No.8;

[0039] 2) Use primer 1 and primer 2 to linearize the pET22b plasmid;

[0040] Primer 1: 5' > CCCTATAGTGAGTCGTATT AACCTAATGCAGGTCCCGGAAGA <3', the underlined sequence is the overlapping sequence with the pET22b plasmid.

[0041] Primer 2: 5'>CCAATGGCGCGCCGAGCTTGGCGTAAT gctcgccacttcgggctcatgagcg <3', the underlined sequence is the overlapping sequence with the pET22b plasmid.

[0042] reaction system:

[0043]

[0044] Reaction conditions:

[0045] PCR amplification reaction conditions

[0046]

[0047] 30cycle.

[0048] 3) To purify the linearized pET22b plasmid, perform gel cutting and recovery:

[0049] a) Cut the strips to be recovered from the electrophoresis gel under a UV lamp, note that the blade needs to be sterilized, and the glue block should be as small as possible to make it easy to melt completel...

Embodiment 2

[0082] Example 2 Construction of recombinant plasmids of proteins anchored by RNA scaffolds

[0083] The ribitol dehydrogenase gene fragment and the formate dehydrogenase gene fragment obtained by querying the Genebank gene library were optimized by using the codon bias of Escherichia coli to determine the aptamer sequence of PP7 shown in SEQ ID No. 4 (aptamer 1) and the aptamer sequence of BIV-TAT shown in SEQ ID No. 5 (aptamer 2), BIV-Tat was labeled with FDH, and PP7 was labeled with RDH. The company synthesized pp7-rdh and biv- tat-fdh gene, the target gene was subcloned into pACYCDuet1, named pACYCDuet1-pp7-rdh::biv-tat-fdh. This construct was transformed into E. coli BLStar cells and expression of the two enzyme fusions was induced by IPTG.

[0084] 1) Use primer 3 and primer 4 to linearize the pACYCDuet1 plasmid;

[0085] Primer 3: 5'> ttaacctaggctgctgccac <3', the underlined sequence is the overlapping sequence with the pACYCDuet1 plasmid.

[0086] Primer 4: 5'> ...

Embodiment 3

[0135] Example 3 Construction of Coliform Engineering Strain

[0136] The recombinant plasmids pACYCDuet1-pp7-rdh::biv-tat-fdh and pET22b-scaffold were co-transformed into Escherichia coli BLStar to construct engineering strain I, which was identified and verified.

[0137] Add 2μl plasmid pET22b-scaffold and 2μl recombinant plasmid pACYCDuet1-pp7-rdh::biv-tat-fdh to 100μl DH5α competent cells, ice bath for 30min, heat shock (42°C, 60S), ice bath for 2min, add 500 μl of fresh anti-LB liquid medium was incubated at 37° C., 180 rpm for 1 h. Take out 200 μl and spread it on chloramphenicol and ampicillin plates, and incubate at 37°C overnight.

[0138] The co-transformed Escherichia coli was spread on a plate containing double resistance to ampicillin and chloramphenicol, and the successfully transformed engineered strain could grow on the double resistance plate, and then screened to obtain a positive strain.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a triangular mesh RNA scaffold for immobilizing recombinant proteins in cells, which consists of a two-dimensional triangular mesh RNA scaffold and an optional aptamer sequence; wherein the RNA scaffold will guide the interaction Sublayer flow between enzymes, limiting cross-interactions and improving the yield of sequential metabolic reactions. The invention also discloses the application of the triangular mesh RNA scaffold used for intracellular immobilization of recombinant protein in the intracellular immobilization of ribitol dehydrogenase and formate dehydrogenase, and the experiment confirms that the engineering bacterium Allo The yield of alcohol can be increased from 3.036g / L to 4.433g / L, which is expected to save costs and improve the efficiency of enzymatic reaction in industrial production, and maximize the yield of products, with broad economic value and application prospects.

Description

technical field [0001] The invention relates to a triangular mesh RNA scaffold for immobilizing intracellular recombinant proteins, a construction method and application thereof. It belongs to the field of biochemical industry. Background technique [0002] The traditional chemical and pharmaceutical industries have defects such as high energy consumption, high material consumption, high pollution and high emissions, which pose serious challenges to resources and the environment. Biocatalysis has environmental friendly features such as energy saving, consumption reduction, low pollution, and low emission. It can replace traditional chemical and pharmaceutical processes, realize industrial transformation and upgrading, and promote green development. In biocatalysis, compared with enzyme catalysis, cell catalysis has many advantages such as no need for cell disruption, separation and purification of enzymes, more stable enzymes in cells, convenient recovery, low cost, and sim...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12N15/115C12N15/70
CPCC12N15/11C12N15/115C12N15/70C12N2310/16
Inventor 林建强柴玉颖任一林孙煦茵温鑫林建群
Owner SHANDONG UNIV