Triangular mesh RNA scaffold for intracellular immobilization of recombinant protein and its construction method and application
A recombinant protein and triangular technology, applied in the direction of recombinant DNA technology, DNA/RNA fragments, biochemical equipment and methods, etc., can solve the problem of low stability of RNA scaffolds, achieve economic value and broad application prospects, and improve enzymatic reactions Efficiency and productivity improvement effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1 Construction of RNA scaffold recombinant plasmid
[0038] 1) The entrusted company to synthesize a DNA sequence as shown in SEQ ID No.8;
[0039] 2) Use primer 1 and primer 2 to linearize the pET22b plasmid;
[0040] Primer 1: 5' > CCCTATAGTGAGTCGTATT AACCTAATGCAGGTCCCGGAAGA <3', the underlined sequence is the overlapping sequence with the pET22b plasmid.
[0041] Primer 2: 5'>CCAATGGCGCGCCGAGCTTGGCGTAAT gctcgccacttcgggctcatgagcg <3', the underlined sequence is the overlapping sequence with the pET22b plasmid.
[0042] reaction system:
[0043]
[0044] Reaction conditions:
[0045] PCR amplification reaction conditions
[0046]
[0047] 30cycle.
[0048] 3) To purify the linearized pET22b plasmid, perform gel cutting and recovery:
[0049] a) Cut the strips to be recovered from the electrophoresis gel under a UV lamp, note that the blade needs to be sterilized, and the glue block should be as small as possible to make it easy to melt completel...
Embodiment 2
[0082] Example 2 Construction of recombinant plasmids of proteins anchored by RNA scaffolds
[0083] The ribitol dehydrogenase gene fragment and the formate dehydrogenase gene fragment obtained by querying the Genebank gene library were optimized by using the codon bias of Escherichia coli to determine the aptamer sequence of PP7 shown in SEQ ID No. 4 (aptamer 1) and the aptamer sequence of BIV-TAT shown in SEQ ID No. 5 (aptamer 2), BIV-Tat was labeled with FDH, and PP7 was labeled with RDH. The company synthesized pp7-rdh and biv- tat-fdh gene, the target gene was subcloned into pACYCDuet1, named pACYCDuet1-pp7-rdh::biv-tat-fdh. This construct was transformed into E. coli BLStar cells and expression of the two enzyme fusions was induced by IPTG.
[0084] 1) Use primer 3 and primer 4 to linearize the pACYCDuet1 plasmid;
[0085] Primer 3: 5'> ttaacctaggctgctgccac <3', the underlined sequence is the overlapping sequence with the pACYCDuet1 plasmid.
[0086] Primer 4: 5'> ...
Embodiment 3
[0135] Example 3 Construction of Coliform Engineering Strain
[0136] The recombinant plasmids pACYCDuet1-pp7-rdh::biv-tat-fdh and pET22b-scaffold were co-transformed into Escherichia coli BLStar to construct engineering strain I, which was identified and verified.
[0137] Add 2μl plasmid pET22b-scaffold and 2μl recombinant plasmid pACYCDuet1-pp7-rdh::biv-tat-fdh to 100μl DH5α competent cells, ice bath for 30min, heat shock (42°C, 60S), ice bath for 2min, add 500 μl of fresh anti-LB liquid medium was incubated at 37° C., 180 rpm for 1 h. Take out 200 μl and spread it on chloramphenicol and ampicillin plates, and incubate at 37°C overnight.
[0138] The co-transformed Escherichia coli was spread on a plate containing double resistance to ampicillin and chloramphenicol, and the successfully transformed engineered strain could grow on the double resistance plate, and then screened to obtain a positive strain.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


