DNA (deoxyribonucleic acid) connector as well as preparation method and application thereof

A DNA sequencing and construction method technology, applied in the fields of DNA adapters and their preparation and application, can solve problems such as unusability and complexity, and achieve the effects of avoiding cost, simple construction method and improving connection efficiency

Pending Publication Date: 2020-07-10
GENESKY TECH (SUZHOU) INC +1
View PDF10 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although these studies can also effectively improve the connection efficiency, complex and high-standard equipment may be required to produce modified enzymes, or it may not be available due to patent protection, or it may be necessary to purchase commercial reagents at a relatively high price. Therefore, it is urgent to develop a simple method to improve library transformation efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA (deoxyribonucleic acid) connector as well as preparation method and application thereof
  • DNA (deoxyribonucleic acid) connector as well as preparation method and application thereof
  • DNA (deoxyribonucleic acid) connector as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Capillary electrophoresis verification of DNA connection efficiency of conventional Y-shaped adapters

[0037] 1. Synthesize the following primer sequences

[0038] DNAQC-F: ccg GAATTC TT[6-FAM-dT]GCCTTCATTGAGCGCTACTT (SEQ ID NO.1)

[0039] DNAQC-R: aaaa CTGCAGTTCCAGGGTCTTTCTCAATCCAG (SEQ ID NO. 2)

[0040] 2. Using the Thermus aquaticus genomic DNA as a template, PCR amplification was carried out with the above primers, and after amplification, a specific double-stranded DNA with a length of 89 bp was obtained.

[0041] 3. After purification using DNA Clean&Concentrator-5 (200Preps) w / Zymo-Spin ICColumns (Capped) from Zymo Company, the quality control DNA fragment obtained was named DNAQC.

[0042] 4. The following linker sequences were chemically synthesized and purified by HPLC.

[0043] Basic-F: ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO. 4)

[0044] Basic-R: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (SEQ ID NO. 5)

[0045] Basic-F-F: [ROX] ACACTCTTTCCCTAC...

Embodiment 2

[0064] Example 2: Capillary Electrophoresis Verification of DNA Ligation Efficiency Containing UMI Sequence Y-shaped Adapter

[0065] 1. Prepare DNA QC with Example 1.

[0066] 2. Chemically synthesize the following fragments and purify using HPLC

[0067] DS-F: [ROX] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO. 8)

[0068] DS-R: TCTTCTACAGTCANNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [HEX] (SEQ ID NO. 9)

[0069] 3. Use H 2 O Dissolve the DS-F / DS-R synthesized above to a final concentration of 100 μM. Take 25 μl of DS-F and 25 μl of DS-R and mix them into 50 μl of DS-AD (final concentration 50 μM) in a 0.2 ml thin-walled tube.

[0070] 4. Place the DS-AD above in a PCR machine for annealing, the condition is denaturation at 95°C for 10 minutes, cooling down to 25°C at 0.1°C / sec; and keeping at 25°C for 2 hours.

[0071] 5. Prepare the system described in Table 5 below for single-strand extension

[0072] table 5

[0073] 50μl A...

Embodiment 3c

[0082] Example 3 cfDNA low-input library construction

[0083] 1. Use the MagMAX cell-free DNA isolation kit from Thermo Fisher to extract cfDNA from 5ml plasma.

[0084] 2. Referring to Example 1, Synthesize Basic-AD and Basic-AD-F.

[0085] 3. Take 5ng and 1ng cfDNA respectively, use conventional library construction reagents for library construction, and prepare the following system in Table 7 to fill in the ends and add A

[0086] Table 7

[0087] 5μl Terminal balance + A buffer 1μl T4 DNA polymerase 1μl T4 PNK 1μl Taq 1ng / 5ng cfDNA Make up to 30μl h 2 o

[0088] Reaction conditions: 20°C for 30 minutes, 70°C for 30 minutes.

[0089] 4. After the end is filled and A is added, the connector is connected, and H is used first 2 O Dilute Basic-AD and Basic-AD-F to 2 μM, and prepare the following system in Table 8:

[0090] Table 8

[0091] 30μl End filling + A segment 26μl ligation buffer 3μl ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a DNA connector. 5' and / or 3' at non-connection tail ends of the DNA connector are sealed. By adopting the DNA connector provided by the invention, non-specific connection ofthe non-connection tail end with a DNA fragment can be avoided, the connection efficiency of the connector with the DNA fragment can be improved, and then the library conversion efficiency can be improved. A preparation method of the DNA connector provided by the invention is simple, a library construction method is simple, efficient and low in cost, and the high expense of transformation enzymesor commercial kits can be avoided.

Description

technical field [0001] The invention specifically relates to a DNA linker and its preparation method and application. Background technique [0002] In next-generation sequencing experiments, DNA sequencing library construction based on DNA adapter ligation is an important and basic experimental technique. In addition to being used alone in the construction of conventional genome sequencing libraries, this technology is also an important link in the construction of RNA-seq, ChIP-seq, RRBS and other libraries. The DNA fragments are a) end-filled, b) added with A, c) DNA adapter ligation and d) enriched by PCR with universal primers matching the adapter sequence and finally transformed into a DNA sequencing library. Obviously, only when DNA adapters are connected to both ends of the DNA fragment at the same time, the fragment can be enriched in the subsequent PCR enrichment process and then sequenced. The ratio of the DNA fragments with double-ended adapters to all DNA fragme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6855C40B50/06
CPCC12Q1/6855C40B50/06
Inventor姜正文方欧
OwnerGENESKY TECH (SUZHOU) INC