Application of ghnac091 gene in improving plant photosynthetic utilization efficiency and strong light tolerance
A gene and plant technology, applied in the fields of botanical equipment and methods, applications, plant products, etc., can solve the problems of low photosynthetic efficiency and weak tolerance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 GhNAC091 Gene expression and functional localization in cells
[0031] Due to the lack of transcription factors related to the NAC class in the prior art Gh_A07G1811 Related reports located at the subcellular level, aiming at the previously obtained GhNAC091 Gene, the inventor first carried out intracellular expression positioning on it, the specific process is as follows:
[0032] 1) Gene amplification
[0033] The upland cotton sequencing standard line TM-1 was kept at 23°C, the photoperiod was 16h light / 8h dark, and the light intensity was about 100 μmol·m -2 ·s -1 It was grown in an incubator for about 4 weeks, and the true leaves were cut off, and stored at -80°C after quick freezing in liquid nitrogen. Extract the total RNA from true leaves, and use the transcription kit (Novazyme R211-01) to reverse transcribe to obtain a high-purity cDNA template;
[0034] design GhNAC091 The cloning primers of the gene, the restriction site at the 5' end of the ...
Embodiment 2
[0047] Example 2 GhNAC091 Gene function verification
[0048] for research GhNAC091 The function of the gene in plant photosynthetic utilization and plant strong light tolerance, the inventor used virus-induced gene silencing (VIGS) technology to construct GhNAC091 Gene silencing plants, and compare the culture effect of gene silencing plants and wild-type plants after strong light irradiation, the specific process is as follows:
[0049] 1) Vector construction
[0050] according to GhNAC091 For the specific region of the gene in Upland Cotton TM-1, the amplification primers for the VIGS fragment were designed, and the specific primer sequences are as follows:
[0051] F: GAATTCCCGGCATTGAGAGTTATGCC
[0052] R: CTCGAGTCAAACATTCATCTGGGTTGGTGA
[0053] Amplified using TM-1 cDNA as template GhNAC091 Gene VIGS fragment, the reaction system is: ddH 2 O 18 μl, 2×Phanta Max Buffer 25 μl, dNTP 1 μl, upstream primer 2 μl, downstream primer 2 μl, Phanta Max Super-Fidelity DNA Pol...
Embodiment 3
[0073] Example 3 GhNAC091 Gene overexpression vector construction
[0074] Preliminary studies have shown GhNAC091 Genes play a key role in improving plant photosynthetic efficiency and enhancing plant resistance to strong light stress. In order to obtain plant materials with strong light tolerance, and further verify GhNAC091 Genes also have the ability to improve plant photosynthetic utilization efficiency in other species, the inventor constructed GhNAC091 Gene overexpression vector, and the overexpression vector into the model organism Arabidopsis for verification, the specific process is as follows:
[0075] 1) Construction of overexpression vector
[0076] according to 35S::VIP:GFP Amplification primers were designed based on the sequence of the vector (preserved in our laboratory and can be obtained from commercially available products) and restriction sites. The specific sequences of the primers are as follows:
[0077] F: AAGCTCCTCGACTCTAGGGCCCATGAACACAGTTAAAGGT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More