Method for detecting cutting efficiency of gene editing target

A technology of gene editing and cutting efficiency, applied in the fields of animal genetic engineering and gene editing, can solve the problems of increasing the cost and time of gene editing, and achieve the effect of sensitive detection

Pending Publication Date: 2020-07-31
重庆英茂盛业生物科技有限公司
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This approach increases the cost and time of gene editing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting cutting efficiency of gene editing target
  • Method for detecting cutting efficiency of gene editing target
  • Method for detecting cutting efficiency of gene editing target

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] A method for constructing a frameshift mutant EGFP reporter gene carrier according to the present invention, such as figure 2 As shown, the implementation steps are as follows:

[0044] (1) Construct the carrier of frameshift mutation EGFP reporter gene, take green fluorescent protein as the frameshift mutation reporter gene carrier pTYNE of reporter gene, utilize restriction endonuclease XbaI, NotI in the frameshift mutation reporter gene carrier pTYNE of reporter gene Insert the frameshift mutant EGFP reporter gene downstream of the start codon ATG, cut the synthetic product, and obtain the carrier of the frameshift mutant EGFP reporter gene;

[0045] (2) The carrier of the frameshift mutant EGFP reporter gene constructed in step (1) is transferred into eukaryotic cells; the frameshift mutant EGFP reporter gene is cloned into the eukaryotic expression vector between the CMV promoter and the SV40 terminator.

Embodiment 2

[0047] A method for detecting gene editing target site cutting efficiency described in the present invention, such as figure 1 , 2 As shown, the implementation steps are as follows:

[0048] (1) Construct two spCas9 and sgRNA co-expression vectors, the frameshift mutation reporter gene vector pTYNE with green fluorescent protein as the reporter gene, and the initiation code of the frameshift mutation reporter gene vector pTYNE using restriction endonucleases Insert spCas9 and sgRNA reporter gene downstream of the sub-ATG, one of which expresses a positive sgRNA that can cut the reporter gene carrier pTYNE; the other expresses a negative sgRNA that cannot cut the reporter gene carrier pTYNE; the steps are as follows:

[0049] 1) Negative and positive sgRNA expression cassettes were synthesized in vitro;

[0050] 2) EcoRV linearized spCas9 and sgRNA co-expression vector spCas9gRNA1;

[0051] 3) Recombine the positive sgRNA expression cassette to the downstream of the U6 promo...

Embodiment 3

[0065] A method for detecting gene editing target site cutting efficiency described in the present invention, such as figure 1 , 2 As shown, the pTYNE reporter gene vector was used to verify the knockout target of the human TP53 gene, and the implementation steps were as follows:

[0066] (1) Design two targets according to the sequence of exon 4 of human TP53;

[0067] Target 1: acctgccctgtgcagctgtggg; Target 2: ttgattccacaccccccgcccgg;

[0068] (2) Construct the pTYNE-TP53 verification vector; connect the partial sequence of the fourth exon of TP53 to the pTYNE vector through the XhoI and HindIII restriction sites, and verify the cutting efficiency of the target through the pTYNE vector. The constructed vector is named pTYNE- TP53; Schematic diagram of the pTYNE-TP53 vector insert sequence after the construction is completed (such as Figure 4 );

[0069] 3. Construct target 1 and target 2 into spCas9 / gRNA1 vector to obtain Cas9 and gRNA co-expression vectors spCas9 / gRNA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting the cutting efficiency of a gene editing target. The method comprises the following steps of constructing a target detection vector containing a frame shift mutation reporter gene; inserting a gene editing target sequence into an N end of the target detection vector containing the frame shift mutation reporter gene to obtain a detection vector; and transferring the detection vector into animal cells, repairing the mutation reporter gene by the cells when endonuclease successfully cuts the target, and detecting the activity of the reporter gene toobtain the target cutting efficiency. The method is sensitive and visual in detection and can be quantified; and target cutting occurs in the cells, which is extremely similar to actual gene editing reaction conditions, and can reflect the target cutting effect in actual gene editing.

Description

technical field [0001] The invention belongs to the field of animal genetic engineering and gene editing, and relates to a method for detecting the gene editing target cutting efficiency of specific nucleases in animal cells, specifically a method for detecting the gene editing target cutting efficiency . Background technique [0002] The key step in the site-directed gene editing technology is to use a specific DNA endonuclease that can recognize and cut a specific DNA sequence to perform site-directed cutting on the genomic DNA of an organism. Different gene editing technologies use different nucleases, such as zinc finger nucleases (ZFNs, zinc finger nucleases), transcription activator-like effector nucleases (TALENs, transcription activator-like effector nucleases), and CRISPR / Cas9 Nuclease. No matter which nuclease is used, the recognition and targeted cutting of specific sites in the genome by nucleases are the core steps of gene editing. In a variety of organisms i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/66C12N15/85C12N15/113C12N15/65C12N15/90C12N9/22G01N21/64
CPCC12Q1/66C12N15/85C12N15/113C12N15/65C12N15/907C12N9/22G01N21/6428C12N2310/20
Inventor桂有静
Owner重庆英茂盛业生物科技有限公司