Unlock instant, AI-driven research and patent intelligence for your innovation.

Infectious bronchitis recombinant virus as well as construction method and application thereof

A bronchitis, chicken infectious technology, applied in the direction of viruses, antiviral agents, viral antigen components, etc.

Inactive Publication Date: 2020-08-07
JIANGSU INST OF POULTRY SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

A large number of literatures now report that live attenuated gene-deleted vaccines have the characteristics of high efficiency and safety, such as the TK gene-deleted vaccine of pseudorabies virus, the nef gene-deleted vaccine of human immunodeficiency virus, and the px gene-deleted vaccine of bovine leukemia virus. There is a research report on chicken infectious bronchitis gene deletion vaccine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Infectious bronchitis recombinant virus as well as construction method and application thereof
  • Infectious bronchitis recombinant virus as well as construction method and application thereof
  • Infectious bronchitis recombinant virus as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Construction of full-length genome cDNA of IBYZ strain (chicken infectious bronchitis virus, deposit number CGMCC No.14682, GenBank accession number KT750258) and virus rescue

[0043] 1. Primer design

[0044] The size of the IBV genome is about 27.6kb. According to the distribution of type IIs restriction endonuclease Bsa I on chicken infectious bronchitis virus, it is divided into YZ1, YZ2, YZ3, YZ4, YZ5, YZ6, YZ7, YZ8, YZ9 and YZ10. 10 fragments were used to amplify the whole genome in segments. Ten pairs of primers covering the entire genome of the virus were designed, and the primer sequences are shown in Table 1. The core sequence of the T7 RNA polymerase promoter was introduced into the upstream primer YZ1S of the YZ1 amplified fragment to ensure that the viral genome RNA could be transcribed in vitro after the full-length cDNA splicing was completed; 28 bases T were introduced into the downstream primer YZ10A, To ensure that there is a polyA tail structure at...

Embodiment 2

[0059] Construction of Gene Deletion Strain of Chicken Infectious Bronchitis Virus

[0060] 1. Construction of 3a3b gene and 5a5b gene deletion plasmids

[0061] Both the 3a3b gene and the 5a5b gene are located in the recombinant plasmid pMDYZ9 constructed above, and primers were designed according to the whole genome sequence of IBYZ to delete the 3a3b gene and or 5a5b gene fragments respectively, and the primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0062] 3a3b gene, 5a5b gene deletion primer sequence is:

[0063] 3a3bS (SEQ ID No.3): 5'TTGAGAAAACAATTGAAACAGG 3';

[0064] 3a3bA (SEQ ID No.4): 5'CTTAATGCAAGTTTAAACCAGAG 3';

[0065] 5a5bS (SEQ ID No.5): 5'TCCTTTTCGCGGAGCAATAGCAAG 3'

[0066] 5a5bA (SEQ ID No. 6): 5'TGAATGCCCTTCCAAAAACTAGTCAG 3'.

[0067] Using the pMDYZ9 plasmid as a template, the primer pairs 3a3bS+3a3bA and 5a5bS+5a5bA were used for PCR amplification, respectively. The high-fidelity enzyme PrimeSTAR HS DNA Pol...

Embodiment 3

[0073] Detection of Biological Characteristics of Chicken Infectious Bronchitis Virus Gene Deletion Strain

[0074] 1. Determination of virus hemagglutination activity

[0075] The P3 seed virus of rIBYZΔ3a3b, rIBYZΔ5a5b and rIBYZΔ3ab5ab strains were inoculated into 10-day-old SPF chicken embryos, and the allantoic fluid was harvested from 36h to 48h, and the final concentration was 1U / mL type I lecithinase C (Sigma) in Treat at 37°C for 90 minutes, and place in a refrigerator at 4°C for 2 weeks, then perform hemagglutination test according to the micro method. The results showed that the seed viruses of rIBYZΔ3a3b, rIBYZΔ5a5b and rIBYZΔ3ab5ab strains without type I lecithinase C treatment and their parental strain rIBYZ had no hemagglutination activity; The hemagglutination value ranged from 5log2 to 7log2, which was basically consistent with the average hemagglutination value of the parental strain rIBYZ, which was 6.2log2.

[0076] 2. Determination of virus growth curve ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an infectious bronchitis recombinant virus as well as a construction method and application thereof, and belongs to the technical field of vaccine preparation. The infectious bronchitis recombinant virus is obtained by deleting a 3a3b gene and / or a 5a5b gene of the infectious bronchitis virus. After the 3a3b gene and / or the 5a5b gene of the avian infectious bronchitis recombinant virus are / is deleted, a gene-deleted strain with weakened toxicity is obtained, effective protection can be provided for infection of homotype virulent viruses; and the virus is used for developing a safe and effective avian infectious bronchitis gene-deleted live vaccine.

Description

technical field [0001] The invention belongs to the technical field of vaccine preparation, and in particular relates to a chicken infectious bronchitis recombinant virus and its construction method and application. Background technique [0002] Chicken infectious bronchitis (Infectious bronchitis, IB) is one of the second-class infectious diseases of poultry stipulated by the International Veterinary Bureau. It is an acute and highly contagious infection caused by infectious bronchitis virus (Infectious bronchitis virus, IBV). sick. IBV belongs to the Gamma coronavirus of the Coronaviridae family. It is a single-stranded positive-sense RNA virus with an envelope and no segments. The genome is about 27.6kb long, with a typical 5′cap and 3′PolyA tail structure, and at least 10 distinct The open reading frame (ORF), which encodes the structural and nonstructural proteins of the virus, respectively. The 2 / 3 genome at the 5' end encodes an active replicase, and the 1 / 3 genome ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01A61K39/215A61P31/14
CPCA61K39/12A61K2039/5254A61K2039/552A61P31/14C12N7/00C12N2770/20021C12N2770/20034
Inventor 周生唐梦君姜逸俞燕高明艳赵秀美程旭韦玉勇
Owner JIANGSU INST OF POULTRY SCI