Infectious bronchitis recombinant virus as well as construction method and application thereof
A bronchitis, chicken infectious technology, applied in the direction of viruses, antiviral agents, viral antigen components, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Construction of full-length genome cDNA of IBYZ strain (chicken infectious bronchitis virus, deposit number CGMCC No.14682, GenBank accession number KT750258) and virus rescue
[0043] 1. Primer design
[0044] The size of the IBV genome is about 27.6kb. According to the distribution of type IIs restriction endonuclease Bsa I on chicken infectious bronchitis virus, it is divided into YZ1, YZ2, YZ3, YZ4, YZ5, YZ6, YZ7, YZ8, YZ9 and YZ10. 10 fragments were used to amplify the whole genome in segments. Ten pairs of primers covering the entire genome of the virus were designed, and the primer sequences are shown in Table 1. The core sequence of the T7 RNA polymerase promoter was introduced into the upstream primer YZ1S of the YZ1 amplified fragment to ensure that the viral genome RNA could be transcribed in vitro after the full-length cDNA splicing was completed; 28 bases T were introduced into the downstream primer YZ10A, To ensure that there is a polyA tail structure at...
Embodiment 2
[0059] Construction of Gene Deletion Strain of Chicken Infectious Bronchitis Virus
[0060] 1. Construction of 3a3b gene and 5a5b gene deletion plasmids
[0061] Both the 3a3b gene and the 5a5b gene are located in the recombinant plasmid pMDYZ9 constructed above, and primers were designed according to the whole genome sequence of IBYZ to delete the 3a3b gene and or 5a5b gene fragments respectively, and the primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0062] 3a3b gene, 5a5b gene deletion primer sequence is:
[0063] 3a3bS (SEQ ID No.3): 5'TTGAGAAAACAATTGAAACAGG 3';
[0064] 3a3bA (SEQ ID No.4): 5'CTTAATGCAAGTTTAAACCAGAG 3';
[0065] 5a5bS (SEQ ID No.5): 5'TCCTTTTCGCGGAGCAATAGCAAG 3'
[0066] 5a5bA (SEQ ID No. 6): 5'TGAATGCCCTTCCAAAAACTAGTCAG 3'.
[0067] Using the pMDYZ9 plasmid as a template, the primer pairs 3a3bS+3a3bA and 5a5bS+5a5bA were used for PCR amplification, respectively. The high-fidelity enzyme PrimeSTAR HS DNA Pol...
Embodiment 3
[0073] Detection of Biological Characteristics of Chicken Infectious Bronchitis Virus Gene Deletion Strain
[0074] 1. Determination of virus hemagglutination activity
[0075] The P3 seed virus of rIBYZΔ3a3b, rIBYZΔ5a5b and rIBYZΔ3ab5ab strains were inoculated into 10-day-old SPF chicken embryos, and the allantoic fluid was harvested from 36h to 48h, and the final concentration was 1U / mL type I lecithinase C (Sigma) in Treat at 37°C for 90 minutes, and place in a refrigerator at 4°C for 2 weeks, then perform hemagglutination test according to the micro method. The results showed that the seed viruses of rIBYZΔ3a3b, rIBYZΔ5a5b and rIBYZΔ3ab5ab strains without type I lecithinase C treatment and their parental strain rIBYZ had no hemagglutination activity; The hemagglutination value ranged from 5log2 to 7log2, which was basically consistent with the average hemagglutination value of the parental strain rIBYZ, which was 6.2log2.
[0076] 2. Determination of virus growth curve ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



