Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Brassica napus gene BnTNLR1, and application thereof in resisting sclerotinia sclerotiorum

A technology for Brassica napus and Sclerotinia sclerotiorum, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of less research on the TNL disease resistance gene family of rapeseed.

Inactive Publication Date: 2020-08-07
SHANXI UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Li Tinggang et al. found that the cotton TIR-NBS-LRR protein GhTNL1 is involved in the defense response of cotton to Verticillium wilt, but there are few studies on the rapeseed TNL disease resistance gene family
[0004] For the prevention and control of sclerotinia, although chemical and biological prevention measures have certain effects in production, each has its own disadvantages. To improve the disease resistance and yield of rapeseed, cultivating disease-resistant varieties of rapeseed is an urgently needed strategy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brassica napus gene BnTNLR1, and application thereof in resisting sclerotinia sclerotiorum
  • Brassica napus gene BnTNLR1, and application thereof in resisting sclerotinia sclerotiorum
  • Brassica napus gene BnTNLR1, and application thereof in resisting sclerotinia sclerotiorum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: BnTNLR1 Obtaining Gene Edited Mutant Plants

[0046] One, test material: the test material in this experiment is Brassica napus line 5147B. The exogenous plasmid used for transformation is the pRGEB31-Cas9-BnTNLR1 plasmid carrying the Cas9 endonuclease gene and gRNA, which also contains the hygromycin resistance selection marker gene for gene editing transformation plant selection, which is regulated by the 35S promoter The regulatory map of the pRGEB31-Cas9-BnTNLR1 plasmid is as follows figure 1 shown. BnTNLR1 Gene target sequence: GGGAAAGAAACCGTCAGAAA TGG (TGG is the PAM sequence).

[0047] 2. Experimental method: In this experiment, pollen-mediated transformation was used. The test material Brassica napus line 5147B was planted in the experimental field of Shanxi Academy of Agricultural Sciences. The specific operation method is as follows:

[0048] (1) In April 2019, the transformation experiment was carried out when the Brassica napus line 5147B...

Embodiment 2

[0063] Example 2: Antibacterial Sclerotinia Identification of Rapeseed Gene Edited Mutant Plants

[0064] 1. Test materials: wild-type plants and mutant plants.

[0065] 2. Experimental method

[0066] A. Analysis of leaf sclerotinia resistance: the wild type and mutant rapeseed leaves at the same position at the 7-8 leaf stage planted in the greenhouse of Shanxi Academy of Agricultural Sciences were used to inoculate sclerotia at the same position of the leaves. After 48h and 72h, the size of the leaf lesion was observed and photographed.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering and molecular breeding, and provides a brassica napus gene BnTNLR1, and application thereof in resisting sclerotinia sclerotiorum. Thenucleotide sequence of the gene is represented by SEQ ID NO.1 in a sequence table, and the gene is a 325bp base. The invention discloses a recombinant vector pRGEB31-Cas9-BnTNLR1. The recombinant vector comprises a nucleotide sequence of a BnTNLR1 gene represented by SEQ ID NO.1 in the claim 1. The invention further discloses a preparation method of the recombinant vector pRGEB31-Cas9-BnTNLR1. Thegene participates in disease resistance of oilseed rape. The gene is knocked out through a CRISPR / Cas9 gene editing technology, so that oilseed rape is more susceptible to diseases. It is shown thatthe BnTNLR1 gene participates in disease resistance of oilseed rape through some ways. Therefore, overexpression of the BnTNLR1 gene is beneficial to selection of a new disease-resistant material in descendants.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and molecular breeding, in particular to a gene of Brassica napus BnTNLR1 And its anti-sclerotinia application. Background technique [0002] As an important oil crop in the world, Brassica napus often suffers from various diseases and insect pests during its growth and development, especially the damage caused by Sclerotinia sclerotiorum, which leads to yield reduction. Plants participate in disease resistance through disease resistance genes (R) during growth and development. Known disease resistance genes (R) are divided into LRR-TM-STK, NBS-LRR, LRR-TM, STK, WRKY, and others according to their structures. etc. Among them, NBS-LRR class R genes are the largest class of disease resistance genes. Studies have shown that the conserved domains of the proteins "TIR", "NBS" and "LRR" of NBS-LRR disease resistance genes have their own functions, and the TIR domain has the function of tra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/00A01H6/20
CPCC12N15/8213C12N15/8282
Inventor 王景雪张珊珊辛世文
Owner SHANXI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com