Method, primer and kit for detecting virulence-regulating gene tcdC of Clostridium difficile ribosome 027-type
A Clostridium difficile and gene-regulating technology, applied in the field of molecular biology detection, can solve the problems of high cross-contamination rate, low specificity, complicated operation, etc., and achieve simplified experimental steps, good specificity, and high amplification efficiency Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Clostridium difficile type RT027 wxya Verification of reaction efficiency of different primers for genes
[0041] 1.1 Design primers
[0042] Gene wxya The amplification and detection of the 117th single nucleotide deletion of the base mutation site uses the mutant type containing the 117th single nucleotide deletion site wxya Plasmid DNA mutant target and wild type without single nucleotide deletion at position 117 wxya Plasmid DNA wild-type targets were used as detection targets for screening dominant primers. Among them, mutant wxya The plasmid DNA sequence is shown in SEQ ID NO: 21, and the 1-157th position is a non-transcribed regulatory sequence, and the 274th position is a single nucleotide deletion.
[0043] SEQ ID NO: 21 (5'-3')
[0044] tttcaaaatatattgaatattcttgatttattttgtaaaattatgcttaggggaaatatattttaggaaaatatgaatatataatttttagtcaactagttattttaagtttttaaattttaaaataaaatatatctaataaaagggagattgtattatgttttctaaaaaaaatgagggtaacgaatttagtaatgaaggaaaagg...
Embodiment 2
[0078] Example 2 Clostridium difficile type RT027 wxya Sensitivity verification of different primers for genes
[0079] Use the primer-activated base mutation sequence amplification detection mixture prepared based on the first to fifth sets of primers to amplify the mutant sequence at 63°C and 90 minutes, and detect the mutants at different concentrations in real time wxya Real-time fluorescence curves of plasmid DNA mutant targets at concentrations of 10 pM, 1 pM, 100 fM, 10 fM, 1 fM, 100 aM, 10 aM, and 0 aM. Use a real-time fluorescent quantitative PCR instrument for detection, and read the fluorescence value every 30s. For the real-time fluorescence curve of the specific results, please refer to Figure 2-6 . The real-time fluorescence curve shows that in this example, for the detection of mutant DNA mutant targets, compared with the first to fourth sets of primers, the fifth set of primers is better, and the concentration that can be detected by using the fifth set of...
Embodiment 3
[0080] Example 3 Clostridium difficile type RT027 wxya Verification of the specificity of the different primers for the gene
[0081] When the total concentration of the fixed target was 10 pM, the mutant target was mixed with the wild-type target so that the proportion of the mutant target was 100%, 10%, 1%, 0.1%, 0.01% and 0%, and used The primer-activated base mutation sequence amplification detection mixture prepared based on the fifth set of primers in the kit of the present invention is used for amplification of the mutant sequence and real-time fluorescence detection under the conditions of 63°C and 90 minutes. For the obtained real-time fluorescence curve, please refer to Figure 7-11 . The real-time fluorescence curve shows: when the fifth set of primers is used, when the proportion of mutant targets is as low as 0.01%, the kit of the present invention can still distinguish 0.01% of mutant targets from wild-type targets with a proportion as high as 99.99%. The POI...
PUM
| Property | Measurement | Unit |
|---|---|---|
| volume | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More