Unlock instant, AI-driven research and patent intelligence for your innovation.

Method and application of obtaining molecular markers related to deformity traits of gynogenetic bighead carp

A gynogenesis and molecular marker technology, applied in the fields of aquatic animal genetics and molecular marker-assisted selection breeding, can solve problems such as no SNP molecular marker reports, and achieve the effects of accurate and reliable identification results, promotion of breeding process, and simple operation.

Active Publication Date: 2021-09-03
INST OF AQUATIC LIFE ACAD SINICA
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There are no reports on SNP molecular markers related to deformity traits of gynogenetic bighead carp and its application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and application of obtaining molecular markers related to deformity traits of gynogenetic bighead carp
  • Method and application of obtaining molecular markers related to deformity traits of gynogenetic bighead carp
  • Method and application of obtaining molecular markers related to deformity traits of gynogenetic bighead carp

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The SNP markers of the present invention are derived from the simplified genome data constructed by the gynogenetic bighead carp 2b-rad method in our laboratory, and the loci significantly related to the deformity traits of bighead carp obtained through analysis.

[0039] (1) The gynogenetic bighead carp used in the experiment was collected from the Zhangdu Lake fishery in Xinzhou District, Wuhan. The bighead carp used was one month old. Six normal bighead carp and six deformed bighead carp were selected. Genomic DNA was extracted from the caudal fin of The 2b-rad method for library construction is mainly divided into enzyme digestion, ligation, amplification and recovery.

[0040] Digestion:

[0041] 2b-RAD bank building was carried out on 6 deformed and 6 normal bighead carps with known deformities and normal body sizes bred in this laboratory. The specific process is as follows (the following is the amount used for each individual):

[0042]

[0043] After mixing...

Embodiment 2

[0063] Design and verification of primers based on long sequences related to deformity traits of gynogenetic bighead carp

[0064] (1) Design a pair of primers according to SEQ ID NO:2, the sequence of which is:

[0065] Forward primer F: TGTTGTCAATGCCCAATACC, as shown in SEQ ID NO:3;

[0066] Reverse primer R: CACAATGTGCCTACGCTGTT, as shown in SEQ ID NO:4;

[0067] (2) Select 65 gynogenetic bighead carps from the same batch of 6-month-old gynogenetic bighead carp cultured in our laboratory, including 34 deformed individuals and 31 normal individuals, and perform PCR verification on their genomic DNA samples. The PCR reaction procedure is as follows :

[0068] PCR loading information

[0069]

[0070]

[0071] PCR program settings

[0072]

[0073] (3) The amplified product is detected by electrophoresis on agarose, and the results are as follows: figure 1 As shown, a 475bp band can be amplified, the amplified product is sequenced by Sanger method, the sequencin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for obtaining molecular markers related to deformity traits of gynogenetic bighead carp and its application. The molecular marker is obtained from the 2b-rad simplified genome of the gynogenetic bighead carp, and is located in the 3'UTR of the rgs7a gene. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 2, at 531 of the sequence There is an allelic mutation (G / A) at the base position. The molecular markers screened by the invention were used to carry out correlation analysis on the deformity traits of gynogenetic bighead carp. The molecular marker screened by the invention can be used in gynogenetic bighead carp deformity assisted selection and bighead carp body shape breeding.

Description

technical field [0001] The invention relates to the technical field of aquatic animal genetics and molecular marker-assisted selection breeding, in particular to a method for obtaining molecular markers related to deformity traits of gynogenetic bighead carp and its application. Background technique [0002] With the vigorous development of intensive aquaculture, fish deformities have received more and more attention. During the growth process of fish, bone deformity will lead to the decline of fish grabbing ability and feeding ability, which will affect growth and even die. The deformed fish that grow up cannot be sold and effectively processed because of their poor appearance, so the appearance of deformed fish will greatly affect the breeding benefits. Types of skeletal deformities include scoliosis, lordosis, operculum curvature, caudal vertebral deformities, and jaw deformities, etc. (Zheng Ke et al. Skeletal development and malformation in mariculture fish larvae and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 罗微微童金苟俞小牧王俊如周颖
Owner INST OF AQUATIC LIFE ACAD SINICA