Unlock instant, AI-driven research and patent intelligence for your innovation.

A set of prawn growth-related SNP markers and their application in breeding

A prawn and marker technology, applied in the direction of recombinant DNA technology, microbial measurement/inspection, biochemical equipment and methods, etc., can solve the problems of inability to fine-map genes, unclear analysis of growth traits, and small number of SNP markers, etc., to improve Breeding progress, reduced breeding costs, simple operation

Active Publication Date: 2022-05-06
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, growth traits are quantitative traits controlled by multiple genes, and the analysis of growth traits is still unclear
In addition, the number of SNP markers used in previous studies is small (6000-20000), and it is impossible to fine-map growth-related genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A set of prawn growth-related SNP markers and their application in breeding
  • A set of prawn growth-related SNP markers and their application in breeding
  • A set of prawn growth-related SNP markers and their application in breeding

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: Obtaining of a group of SNP markers related to the growth of prawns

[0032] (1) Construction and trait determination of shrimp analysis population

[0033] The shrimp population used for analysis (Litopenaeus vannamei) was established in Hainan Guangtai Ocean Breeding Co., Ltd. in 2015. This population contains 13 full-sib families of shrimp. The establishment periods of these families are basically similar. Different families were cultured separately. After the family grew to about 3cm, 50 individuals were randomly selected from each family for VIE fluorescent labeling (NMT Company, USA), and the labeled shrimp were cultured under the same conditions. After 3 months of breeding, random selection The body weight of 200 individuals was measured, and the sex of the individuals was recorded.

[0034] (2) Sample DNA extraction

[0035] Use the Plant Genome Extraction Kit (Tiangen, Beijing) to extract the muscle tissue DNA of the above 200 individuals. For t...

Embodiment 2

[0085] Example 2: Application of SNP2570_399791 marker in breeding

[0086] (1) Sources of breeding materials

[0087] The group used for analysis (Litopenaeus vannamei) was constructed at Hainan Guangshun Taipu Marine Breeding Co., Ltd. This group is a mixture of multiple families with the same breeding environment. After 3 months of breeding, 300 individuals were randomly selected , take the last pair of swimming feet for DNA extraction.

[0088] (2) Sample DNA extraction

[0089] The plant genome extraction kit (Tiangen, Beijing) was used to extract DNA from the above 300 individual tissues. For specific operation steps, refer to the kit instruction manual. The concentration of each individual DNA was measured using a nucleic acid concentration analyzer Nanodrop 1000, and detected by agarose gel electrophoresis. DNA integrity. (3) Marker typing of SNP2570_399791

[0090] Use primers to amplify the target sequence amplified by SNP2570F: CGAAATGCGAATCAGCCTTGA and SNP2570R...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular marker assisted breeding of aquatic animals, and in particular relates to a group of SNP markers related to the growth of prawns and their application in breeding. The growth-related markers are shown in the sequences SNP3085_190487, SNP1678_860109, SNP3406_465799, and SNP2570_399791, and the dominant genotypes of the markers are CC, GG, GG, and CC, respectively. By genotyping one or more SNP markers and Marker selection can significantly increase the growth rate of prawns. The invention also discloses the application of a group of growth-related markers in genetic breeding. Compared with traditional breeding methods, the use of trait-related molecular marker-assisted breeding has the characteristics of accuracy and efficiency, and multiple markers provided by this patent can be used in combination to achieve rapid improvement of growth traits through marker aggregation, and in the cultivation of high-yielding varieties has broad application prospects.

Description

technical field [0001] The invention belongs to the field of genetic breeding and molecular breeding of aquatic animals, and in particular relates to a group of SNP markers related to the growth of prawns and their application in breeding. Background technique [0002] Shrimp farming is an important part of mariculture in my country. The annual output of prawns in my country is more than 1.6 million tons, of which Litopenaeus vannamei is the main cultured species, accounting for more than 90% of the production of prawns in my country. Litopenaeus vannamei is also the prawn species with the largest aquaculture output in the world, with an annual output value of 24 billion U.S. dollars. It is the aquaculture animal with the highest output value of a single species in the world aquatic trade. [0003] Genetic breeding has made an important contribution to the development of the shrimp aquaculture industry. Growth traits, as economic traits directly related to yield, are the mai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/156C12Q2600/124
Inventor 于洋李富花吕丁张晓军相建海
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI