Method for efficiently knocking out TIGIT gene in NK cell

A kind of NK cell and high-efficiency technology, applied in the field of gene editing, has achieved obvious application prospects and clinical application value, high knockout efficiency and strong anti-tumor activity

Active Publication Date: 2020-12-25
SHANGHAI UNIV OF T C M
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CRISPR / Cas9 is a new type of nuclease system derived from prokaryotes. It consists of two elements, the guide sequence sgRNA and the nuclease Cas9. At present, the CRISPR / Cas9 system has been successfully used in humans, mice, zebrafish, and Arabidopsis. , rice, Drosophila, silkworm and other species have achieved gene knockout, but so far there has been no report on the knockout of the TIGIT gene in NK cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficiently knocking out TIGIT gene in NK cell
  • Method for efficiently knocking out TIGIT gene in NK cell
  • Method for efficiently knocking out TIGIT gene in NK cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] A method for efficiently knocking out the TIGIT gene in NK cells, comprising the following specific steps:

[0037] 1. Expansion and culture of NK cells

[0038] 1) Take out the frozen human peripheral blood mononuclear cells (PBMC) from liquid nitrogen, and thaw them rapidly in a water bath at 37°C;

[0039]2) Add 4 mL of RPMI-1640 complete culture solution containing 10% FBS and 1% penicillin / streptomycin double antibody to a new 15 mL centrifuge tube, and transfer 1 mL of PBMC suspension to the 15 mL centrifuge tube;

[0040] 3) Centrifuge at 250×g for 5 minutes at room temperature;

[0041] 4) Discard the supernatant and resuspend the cells in 1 mL RPMI-1640 culture medium;

[0042] 5) Add 19 mL of RPMI-1640 culture medium into a new 75 mL cell culture flask, and transfer the above cell suspension to the culture flask;

[0043] 6) Add human recombinant IL-2 protein to the culture flask, the final concentration is 200U / mL;

[0044] 7) Place the culture flask at 3...

Embodiment 2

[0075] Detection of gene knockout efficiency by flow cytometry:

[0076] 1) Collect wild-type or NK cells after knocking out the TIGIT gene and wash twice with 1×PBS containing 1% fetal bovine serum (FBS);

[0077] 2) Resuspend the cells with PBS containing 1% FBS and count, and adjust the cell concentration to 3×10 6 a / mL;

[0078] 3) Add 50 μL of the above cell suspension into a new 1.5 mL centrifuge tube, add 1 μL of PE-anti TIGTI antibody, and incubate at 4°C in the dark for 30 min;

[0079] 4) Wash twice with 1% FBS 1×PBS;

[0080] 5) Resuspend the cells with 300 μL 1% FBS 1×PBS and perform flow cytometry detection.

[0081] Test results such as Figure 2A and 2B shown by Figure 2A and 2B The results shown show that sgRNA-1 and 2 have higher knockout efficiency than sgRNA-3 and 4, and sgRNA-2 has less effect on cell viability than sgRNA-1, as shown in Table 1 for details:

[0082] Table 1 TIGIT knockout efficiency detected by flow cytometry

[0083] na...

Embodiment 3

[0086] The phosphorylation-modified gRNA targeting TIGIT was purchased from GenScript Biotechnology Co., Ltd. The specific phosphorylation sites are: 3 thiol and methoxy modifications at the 3' end and 5' end respectively.

[0087] The specific sequence is TIGIT-2: CTGGTGTCTCCTCCTGATCT

[0088] Figure 3A It shows the comparison of the cell activity of NK cells after the unmodified and phosphorylated sgRNA-2 sequences targeting TIGIT were electroporated by the CM137 program, and the WT group was NK cells electroporated with only Cas9 protein but not electroporated sgRNA ;

[0089] Figure 3B It shows the comparison of the knockout efficiency of TIGIT gene after electroporation of unmodified and phosphorylated sgRNA-2 sequences targeting TIGIT, where CD56 is a surface marker of human NK cells, and the WT group is only electroporated with Cas9 NK cells with protein but not electroporated sgRNA;

[0090] Figure 3C Comparison of sequencing analysis results of unmodified and ph...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for efficiently knocking out a TIGIT gene in an NK cell. The method uses a CRISPR / Cas9 gene editing system to introduce a compound of sgRNA and Cas9 proteins into theamplified NK cell in an electroporation transfection manner, and the sequence of the sgRNA is any one selected from sequences shown in SEQ ID NO.1-4. By adopting the method disclosed by the invention,the knockout efficiency of the TIGIT gene in the NK cell can be close to 80%, the knockout efficiency is high, and the obtained NK cell not expressing the TIGIT can relieve the immunosuppressive effect of CD155 + tumor cells on the NK cell. Compared with wild NK cells, the obtained NK cell not expressing the TIGIT shows stronger anti-tumor activity in in-vivo and in-vitro experiments. The recognition and killing activity of the NK cell on tumor cells is obviously improved, and the NK cell is expected to be developed into a safe and effective anti-tumor biological preparation.

Description

technical field [0001] The invention relates to a method for efficiently knocking out the TIGIT gene in NK cells, belonging to the technical field of gene editing. Background technique [0002] Natural killer cells (natural killer cells, NK cells) are important immune cells of the body, derived from bone marrow lymphoid stem cells, their differentiation and development depend on the microenvironment of bone marrow and thymus, and are mainly distributed in bone marrow, peripheral blood, liver, spleen, and lung and lymph nodes. NK cells are different from T and B cells. They are a type of lymphocytes that can non-specifically kill tumor cells and virus-infected cells without prior sensitization. They are not only related to anti-tumor, anti-viral infection and immune regulation, but also in some cases Participate in the occurrence of hypersensitivity and autoimmune diseases, and can identify target cells and killing mediators. [0003] Studies have shown that although NK cel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/87C12N15/113C12N9/22C12N15/12C12N5/10
CPCC12N15/87C12N15/1138C12N9/22C07K14/70503C12N5/0646C12N2310/20C12N2330/51C12N2510/00
Inventor朱诗国姚超于文霞
OwnerSHANGHAI UNIV OF T C M