Method for efficiently knocking out TIGIT gene in NK cell
A kind of NK cell and high-efficiency technology, applied in the field of gene editing, has achieved obvious application prospects and clinical application value, high knockout efficiency and strong anti-tumor activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] A method for efficiently knocking out the TIGIT gene in NK cells, comprising the following specific steps:
[0037] 1. Expansion and culture of NK cells
[0038] 1) Take out the frozen human peripheral blood mononuclear cells (PBMC) from liquid nitrogen, and thaw them rapidly in a water bath at 37°C;
[0039]2) Add 4 mL of RPMI-1640 complete culture solution containing 10% FBS and 1% penicillin / streptomycin double antibody to a new 15 mL centrifuge tube, and transfer 1 mL of PBMC suspension to the 15 mL centrifuge tube;
[0040] 3) Centrifuge at 250×g for 5 minutes at room temperature;
[0041] 4) Discard the supernatant and resuspend the cells in 1 mL RPMI-1640 culture medium;
[0042] 5) Add 19 mL of RPMI-1640 culture medium into a new 75 mL cell culture flask, and transfer the above cell suspension to the culture flask;
[0043] 6) Add human recombinant IL-2 protein to the culture flask, the final concentration is 200U / mL;
[0044] 7) Place the culture flask at 3...
Embodiment 2
[0075] Detection of gene knockout efficiency by flow cytometry:
[0076] 1) Collect wild-type or NK cells after knocking out the TIGIT gene and wash twice with 1×PBS containing 1% fetal bovine serum (FBS);
[0077] 2) Resuspend the cells with PBS containing 1% FBS and count, and adjust the cell concentration to 3×10 6 a / mL;
[0078] 3) Add 50 μL of the above cell suspension into a new 1.5 mL centrifuge tube, add 1 μL of PE-anti TIGTI antibody, and incubate at 4°C in the dark for 30 min;
[0079] 4) Wash twice with 1% FBS 1×PBS;
[0080] 5) Resuspend the cells with 300 μL 1% FBS 1×PBS and perform flow cytometry detection.
[0081] Test results such as Figure 2A and 2B shown by Figure 2A and 2B The results shown show that sgRNA-1 and 2 have higher knockout efficiency than sgRNA-3 and 4, and sgRNA-2 has less effect on cell viability than sgRNA-1, as shown in Table 1 for details:
[0082] Table 1 TIGIT knockout efficiency detected by flow cytometry
[0083] na...
Embodiment 3
[0086] The phosphorylation-modified gRNA targeting TIGIT was purchased from GenScript Biotechnology Co., Ltd. The specific phosphorylation sites are: 3 thiol and methoxy modifications at the 3' end and 5' end respectively.
[0087] The specific sequence is TIGIT-2: CTGGTGTCTCCTCCTGATCT
[0088] Figure 3A It shows the comparison of the cell activity of NK cells after the unmodified and phosphorylated sgRNA-2 sequences targeting TIGIT were electroporated by the CM137 program, and the WT group was NK cells electroporated with only Cas9 protein but not electroporated sgRNA ;
[0089] Figure 3B It shows the comparison of the knockout efficiency of TIGIT gene after electroporation of unmodified and phosphorylated sgRNA-2 sequences targeting TIGIT, where CD56 is a surface marker of human NK cells, and the WT group is only electroporated with Cas9 NK cells with protein but not electroporated sgRNA;
[0090] Figure 3C Comparison of sequencing analysis results of unmodified and ph...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com