Supercharge Your Innovation With Domain-Expert AI Agents!

Molecular marker used for early screening cervical cancer, primer, method and kit

A molecular marker, cervical cancer technology, applied in biochemical equipment and methods, microbial determination/examination, DNA/RNA fragments, etc., can solve the problems of low specificity, high sensitivity, excessive medical treatment, etc. more specific effects

Active Publication Date: 2021-01-08
CENT SOUTH UNIV +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, hrHPV will naturally subside within a period of time. Although hrHPV screening results are objective, independent of cytologists, and have high sensitivity, the specificity is low (19.5%-28.8%), which leads to excessive medical treatment
However, there is no EDN3 gene methylation detection kit on the market, and the existing technology cannot quickly and efficiently perform relevant and accurate detection of cervical cancer at a low cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker used for early screening cervical cancer, primer, method and kit
  • Molecular marker used for early screening cervical cancer, primer, method and kit
  • Molecular marker used for early screening cervical cancer, primer, method and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 A specific primer for EDN3 methylation detection

[0051] The PCR primers and probes for EDN3-specific methylation of the present invention are based on the human whole genome sequence published by NCBI (National Center for Biotechnology Information), using Primer Premier3.0 and Methyl Primer Express v1.0 design, by the British Synthesized by Weijieji (Shanghai) Trading Co., Ltd.

[0052] The specific primer pair base sequence for amplifying the EDN3 gene fragment from the sample nucleic acid DNA is:

[0053] EDN3-F: GGAGTAGGGGTTGTGGTTT

[0054] EDN3-R: biotin-AATCCCCCCCCCTAAATCCTTT

[0055] The sequencing primers for pyrosequencing the obtained nucleic acid fragments are:

[0056] EDN3-S: TTTTTTTTAGGGTTTATAGTGATTT.

Embodiment 2

[0057] Embodiment 2 A kind of detection kit for EDN3 methylation

[0058] The EDN3 methylation detection kit includes: PCR reaction solution, sequencing primers, negative control, positive control, and blank control.

[0059] The PCR reaction solution includes: nuclease-free water, 10×Ex Buffer (containing Mg2+), dNTPs, EDN3-F, EDN3-R, Ex Taq enzyme. Final concentrations of various substances PCR buffer (1×), dNTP (0.25mM), EDN3-F (0.4uM), EDN3-R (0.4uM), Ex Taq enzyme (1U / reaction).

[0060] Including the following primers, probe sequences are as follows:

[0061] EDN3-F: GGAGTAGGGGTTGTGGTTT

[0062] EDN3-R: biotin-AATCCCCCCCCCTAAATCCTTT

[0063] The sequencing primers include: EDN3-S (10uM).

[0064] Include the sequencing primer sequences as follows:

[0065] EDN3-S: TTTTTTTTAGGGTTTATAGTGATTT

[0066] The negative control is 20ng / uL gDNA of C33A cell line;

[0067] The positive control is 20ng / uL Caski cell line gDNA;

[0068] Wherein the blank control is nuclease...

Embodiment 3

[0069] Example 3 Application of the kit of the present invention in the diagnosis of cervical cancer

[0070] The nuclease-free water, 10×Ex Buffer, Ex Taq enzyme, and dNTPs used in the present invention were purchased from Yubao Biology (Dalian) Co., Ltd.;

[0071] The positive control is Caski cell line gDNA, and the negative control is C33A cell line gDNA;

[0072] The DNA extraction kit is HiPure Blood&Tissue DNA Kit (Magen);

[0073] The transformation kit is EZ DNA Methylation-Direct TM Kit (ZYMO).

[0074] All the biological materials used in the present invention come from the Xiangya Medical Laboratory of Central South University.

[0075] method:

[0076] 1. Biological samples:

[0077] From June 2019 to June 2020, the cervical exfoliated cells of 40 cases of normal people and 35 cases of cervical cancer were collected by the Xiangya Medical Laboratory of Central South University.

[0078] 2. Extract DNA from cervical exfoliated cells:

[0079] 1. Take 1mL of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker used for early screening cervical cancer, a primer, a method and a kit. The molecular marker is obtained by methylation of an EDN3 gene, the methylation of the EDN3 gene is methylation of four CpG sites at the 339-351st site of SEQ ID NO: 4, the primer comprises a specific primer pair for amplifying an EDN3 gene segment from sample nucleic acid DNA and asequencing primer for performing pyrosequencing on the obtained nucleic acid segment. the invention further provides a method for obtaining the molecular marker used for early screening the cervical cancer, and a develops a detection kit. The method has the characteristics of high sensitivity and high specificity, useful information is indirectly provided for early diagnosis of the cervical cancer, and a simple and effective detection method is provided for early detection and early treatment of the cervical cancer.

Description

technical field [0001] The invention relates to the technical field of in vitro diagnostic molecular markers, in particular to molecular markers, primers, methods and kits for early screening of cervical cancer. Background technique [0002] Cervical cancer is the fourth most common malignant tumor threatening women's health. Among female malignant tumors, cervical cancer is second only to breast cancer. Modern medicine believes that the most effective treatment for cervical cancer is early detection, early diagnosis, and early treatment. At present, the cervical cancer screening methods clinically used in China have made great contributions to the health of Chinese women, but there are also inevitable defects. [0003] First of all, traditional cytology screening methods, including bus smear and liquid-based cytology (TCT), have high specificity and positive predictive value, but there are always limitations such as low sensitivity, poor repeatability, and subjective diag...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6869C12N15/11
CPCC12Q1/6886C12Q1/6869C12Q2600/154C12Q2600/106C12Q2531/113C12Q2565/301
Inventor 李清周宏灏李书陈焱安宇航杨礼朱鹏
Owner CENT SOUTH UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More