Molecular marker used for early screening cervical cancer, primer, method and kit
A molecular marker, cervical cancer technology, applied in biochemical equipment and methods, microbial determination/examination, DNA/RNA fragments, etc., can solve the problems of low specificity, high sensitivity, excessive medical treatment, etc. more specific effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1 A specific primer for EDN3 methylation detection
[0051] The PCR primers and probes for EDN3-specific methylation of the present invention are based on the human whole genome sequence published by NCBI (National Center for Biotechnology Information), using Primer Premier3.0 and Methyl Primer Express v1.0 design, by the British Synthesized by Weijieji (Shanghai) Trading Co., Ltd.
[0052] The specific primer pair base sequence for amplifying the EDN3 gene fragment from the sample nucleic acid DNA is:
[0053] EDN3-F: GGAGTAGGGGTTGTGGTTT
[0054] EDN3-R: biotin-AATCCCCCCCCCTAAATCCTTT
[0055] The sequencing primers for pyrosequencing the obtained nucleic acid fragments are:
[0056] EDN3-S: TTTTTTTTAGGGTTTATAGTGATTT.
Embodiment 2
[0057] Embodiment 2 A kind of detection kit for EDN3 methylation
[0058] The EDN3 methylation detection kit includes: PCR reaction solution, sequencing primers, negative control, positive control, and blank control.
[0059] The PCR reaction solution includes: nuclease-free water, 10×Ex Buffer (containing Mg2+), dNTPs, EDN3-F, EDN3-R, Ex Taq enzyme. Final concentrations of various substances PCR buffer (1×), dNTP (0.25mM), EDN3-F (0.4uM), EDN3-R (0.4uM), Ex Taq enzyme (1U / reaction).
[0060] Including the following primers, probe sequences are as follows:
[0061] EDN3-F: GGAGTAGGGGTTGTGGTTT
[0062] EDN3-R: biotin-AATCCCCCCCCCTAAATCCTTT
[0063] The sequencing primers include: EDN3-S (10uM).
[0064] Include the sequencing primer sequences as follows:
[0065] EDN3-S: TTTTTTTTAGGGTTTATAGTGATTT
[0066] The negative control is 20ng / uL gDNA of C33A cell line;
[0067] The positive control is 20ng / uL Caski cell line gDNA;
[0068] Wherein the blank control is nuclease...
Embodiment 3
[0069] Example 3 Application of the kit of the present invention in the diagnosis of cervical cancer
[0070] The nuclease-free water, 10×Ex Buffer, Ex Taq enzyme, and dNTPs used in the present invention were purchased from Yubao Biology (Dalian) Co., Ltd.;
[0071] The positive control is Caski cell line gDNA, and the negative control is C33A cell line gDNA;
[0072] The DNA extraction kit is HiPure Blood&Tissue DNA Kit (Magen);
[0073] The transformation kit is EZ DNA Methylation-Direct TM Kit (ZYMO).
[0074] All the biological materials used in the present invention come from the Xiangya Medical Laboratory of Central South University.
[0075] method:
[0076] 1. Biological samples:
[0077] From June 2019 to June 2020, the cervical exfoliated cells of 40 cases of normal people and 35 cases of cervical cancer were collected by the Xiangya Medical Laboratory of Central South University.
[0078] 2. Extract DNA from cervical exfoliated cells:
[0079] 1. Take 1mL of...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com