Construction method of echinococcus granulosus immunogenic protein EG95 constitutive expression vector
A technology of Echinococcus granulosus and immunogenicity, applied in the field of genetic engineering, to achieve the effect of reducing the production cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] 1. Construction method of expression vector pGAPZαA-Eg95
[0031] 1.1 Modification of the main immunogenic protein EG95 gene of Echinococcus granulosus
[0032]On the basis of the complete EG95 protein, the signal peptide sequence of 16 amino acids was removed from the N-terminus, and 21 amino acids were truncated from the C-terminus, and the codon usage bias and codon degeneracy of the yeast expression system were compared. The Eg95 gene is codon optimized, and the modified Eg95 gene sequence (5'-3') is as follows:
[0033] CAGGAATACAAGGGTATGGGTGTTGAGACTCGTACGACTGAGACTCCTTTGAGGAAACACTTTAACCTGACCCCAGTTGGATCGCAAGGTATCAGACTTTCATGGGAAGTGCAACATCTGTCTGATTTGAAAGGTACCGACATCTCCCTGAAAGCTGTCAATCCTTCCGATCCCTTGGTTTACAAGAGACAAACAGCAAAGTTTAGCGACGGTCAGCTAACAATTGGAGAGTTAAAACCATCTACTTTGTATAAGATGACCGTTGAAGCTGTGAAGGCTAAAAAGACAATTCTTGGCTTCACTGTGGATATTGAGACTCCAAGAGCCGGAAAAAAGGAAAGTACTGTAATGACA
[0034] The amino acid sequence of the EG95 protein is as follows:
[0035] QEYKGMGVETRTTETPLRK...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com