Method for increasing yield of ascomycin by using polyhydroxybutyrate as intracellular carbon library

A technology of polyhydroxybutyric acid and ascomycin, applied in the field of Streptomyces genetic engineering, can solve the problem that the impact of antibiotic production has not been reported, and achieve the effect of increasing production

Active Publication Date: 2021-02-02
TIANJIN UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, to date, the effect of PHB on antibiotic production has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing yield of ascomycin by using polyhydroxybutyrate as intracellular carbon library
  • Method for increasing yield of ascomycin by using polyhydroxybutyrate as intracellular carbon library
  • Method for increasing yield of ascomycin by using polyhydroxybutyrate as intracellular carbon library

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0036] 1. Amplification and verification of PHB synthesis gene phaC.

[0037] (1) Design and synthesis of phaC gene amplification primers. According to the nucleic acid sequence of the PHB synthetic gene phaC (as shown in SEQ ID NO: 1), the amplification primers containing the restriction site and the RBS sequence are designed as follows (the underlined line indicates the NdeI restriction site, and the double underscore indicates the RBS sequence). Synthesized by Jinweizhi Biotechnology Co., Ltd.

[0038] OphaC-fkbU-F1:GGAATTCCATATGGCGACCGGCAAAGGCGCGGCAG

[0039]

[0040] (2) Genome extraction of strain Ralstonia eutropha H16. Ralstonia eutropha H16 was cultured at 150rpm at 30°C for 16 hours in a seed medium adapted to its growth (Nutrient Broth medium formula: peptone 10g / L, beef extract 3g / L, sodium chloride 5g / L, PH7.0) , to obtain fresh seed liquid for the extraction of genome; the fresh seed liquid was centrifuged at 12000rpm for 2 minutes to collect the thalline, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for increasing the yield of ascomycin by using polyhydroxybutyrate as an intracellular carbon library. A polyhydroxybutyrate synthetic gene phaC from ralstonia eutrophaand a polyhydroxybutyrate decomposition gene fkbU from streptomyces hygroscopicus ascus subspecies are integrated in series to a genome of an original strain Streptomyces hygroscopicus var.ascomyceticus ATCC14891 by using a genetic engineering technology, and continuous production of ascomycin is promoted by exerting the effects of polyhydroxybutyrate on storage, degradation and reuse of a carbonsource, so that the fermentation yield of the ascomycin in the genetic engineering strain reaches 626.30 mg / L, which is increased by 211% compared with the original strain ATCC14891. The method provided by the invention provides a new strategy for high yield of the ascomycin, and the method has potential application value in industrial production of FK520.

Description

technical field [0001] The invention belongs to the technical field of Streptomyces genetic engineering, and specifically relates to a method of using polyhydroxybutyric acid as intracellular carbon by serially integrating polyhydroxybutyric acid synthesis gene phaC and decomposition gene fkbU into the genome of Streptomyces hygroscopicus ascus subsp. A method for improving ascomycin production in a library. Background technique [0002] Ascomycin (FK520 for short) is a natural macrolide antibiotic produced by fermentation of Streptomyces hygroscopicus var.ascomyceticus. Due to its special physical structure, FK520 has various physiological and pharmacological activities, such as antifungal, antimalarial, immunosuppressive and anticonvulsant effects. Therefore, FK520 has shown broad application prospects in the medical field. However, as a secondary metabolite with a complex structure, the current fermentation yield of FK520 is still at a low level, which severely limits i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P17/18C12N15/76C12R1/55
CPCC12P17/188C12N15/76C12N9/1029C12N9/00Y02A50/30
Inventor闻建平王盼银莹
OwnerTIANJIN UNIV