Wheat salt-tolerant gene TaAAP3 and application thereof
A wheat salt-tolerant gene and genetic technology, applied in the fields of application, genetic engineering, DNA/RNA fragments, etc., to achieve the effect of improving milk salt capacity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Cloning TaAAP3 Gene from Wheat
[0030] 1. Primer Design
[0031] Search in NCBI with the mRNA sequence of Goat grass AAP3 (GeneBank: XM_020311037.1) to obtain the wheat mRNA sequence (GenBank: AK449433.1). According to this sequence, the primer sequences were designed as follows:
[0032] TAAPCF1: ATGGGGGAGAACGGCGTGGGCAAGAACTAC (SEQ ID No. 2),
[0033] TAAPCR1:
[0034] GGACTAGTCC TCAGTCAGTTGTGAAGAACGGCTTGTAG (SEQ ID No. 1);
[0035] Using the above primers (the base with a horizontal line at the bottom of the primer is the restriction site of the introduced Spe1 endonuclease, which is convenient for the construction of the subsequent expression vector) to perform PCR amplification on the genomic DNA of the new upland wheat variety Jimai 262.
[0036] 2. PCR reaction system and procedures
[0037] 50μl reaction system:
[0038]
[0039]
[0040] The PCR reaction program is: the PCR reaction program is: 94°C for 4min; 94°C for 30s, 60°C for 30s, 7...
Embodiment 2
[0048] Example 2 Expression pattern of TaAAP3 gene under salt stress
[0049] Design primers using the cDNA sequence of TaAAP3 that has been cloned
[0050] QAAP3F: CGCCTACTCCTATTCGCTCATCC (SEQ ID No. 4),
[0051] QAAP3R: ACCCTGACTTGGGCCACCTCT (SEQID No.5); select the plump seeds of Jimai 262, place them in a petri dish with a diameter of 9 cm, and cultivate them in a light incubator at a constant temperature of 25°C for 3 days, then select seedlings with the same growth state and transplant them to plastic In the culture box, when the 1 / 2 Hogland culture medium is cultivated to two leaves and one heart, it is used for salt stress treatment: the material to be treated is placed in an aqueous solution containing 250mmol / L NaCl for growth; the treatment time is 0h, 6h, 12h and 24h, 48h, 24 hours after rehydration, all the parts are roots, stems and leaves. RNA extraction and reverse transcription were performed on the collected materials. Wherein the RNA extraction method is: ...
Embodiment 3
[0073] Construction of embodiment 3 expression vector (PTCK303-TaAAP3) and wheat transgene
[0074] The PMD-18T plasmid containing the target gene TaAAP3 gene was double-digested with BamHI and SpeI endonucleases, and the small fragments after digestion were gel recovered, and at the same time, BamHI and SpeI endonucleases were used to treat PTCK303 ( Figure 4 ) for double enzyme digestion ( Figure 5 ), the large fragments were recovered from the gel, and the two fragments recovered from the gel were ligated using T4 ligase. The ligation product was transformed into Escherichia coli competent cells, and the positive colonies were verified by colony PCR. Then, the positive colonies were expanded and cultivated, the plasmid was extracted, and the plasmid was double-digested with BamHI and SpeI endonucleases to verify whether the size of the fragment after digestion was the same as the size of the target gene. Transformation of plasmids into Agrobacterium for wheat transgenes...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com