Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Latex enhanced turbidimetry detection kit for hepcidin prepared on basis of monoclonal antibody

A monoclonal antibody and detection kit technology, applied in biological testing, anti-hormone immunoglobulin, anti-animal/human immunoglobulin, etc., can solve the problem of high detection cost, poor antigenicity, and small detection volume and other issues to achieve good practical and economic value, high automation and low cost

Pending Publication Date: 2021-02-09
江苏沃兴生物科技有限公司
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the problems that HEPCIDIN has poor antigenicity, the existing detection method of HEPCIDIN takes too long, the detection amount is too small, and the detection cost is too high to be promoted clinically, the present invention provides a latex enhancement ratio of hepcidin prepared based on monoclonal antibody Nephelometric detection kit, using fusion protein to enhance antigenicity, realize latex-enhanced turbidimetric detection of HEPCIDIN, replace mass spectrometry detection method, improve detection efficiency, and expand detection sample size

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Latex enhanced turbidimetry detection kit for hepcidin prepared on basis of monoclonal antibody
  • Latex enhanced turbidimetry detection kit for hepcidin prepared on basis of monoclonal antibody
  • Latex enhanced turbidimetry detection kit for hepcidin prepared on basis of monoclonal antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] This embodiment is the preparation of recombinant human HEPCIDIN protein, which specifically includes the following steps:

[0055] (1) Cutting of human HEPCIDIN protein gene

[0056] The complete gene sequence of human HEPCIDIN is as follows:

[0057] ACCAGAGCAAGCTCAAGACCCAGCAGTGGGACAGCCAGACAGACGGCACGATGGCACTGAGCTCCCAGATCTGGGCCGCTTGCCTCCTGCTCCTCCTCCTCCTCGCCAGCCTGACCAGTGGCTCTGTTTTCCCACAACAGACGGGACAACTTGCAGAGCTGCAACCCCAGGACAGAGCTGGAGCCAGGGCCAGCTGGATGCCCATGTTCCAGAGGCGAAGGAGGCGAGACACCCACTTCCCCATCTGCATTTTCTGCTGCGGCTGCTGTCATCGATCAAAGTGTGGGATGTGCTGCAAGACGTAGAACCTACCTGCCCTGCCCCCGTCCCCTCCCTTCCTTATTTATTCCTGCTGCCCCAGAACATAGGTCTTGGAATAAAATGGCTGGTTCTTTTGTTTTCCAAA

[0058] Artificially cutting the first sequence is:

[0059] ACCAGAGCAAGCTCAAGACCCAGCAGTGGGACAGCCAGACAGACGGCACGATGGCACTGAGCTCCCAGATCTGGGCCGCTTGCCTCCTGCTCCTCCTCCTCCTCGCCAGCCTGACCAGTGGCTCTGTTTTCCCACAACAGACGGGACAACTTGCAGAGCTGCAACCCCAGGACAGAGCTGGAGCCAGGCCAGCCCTGGATGCCCATGTTCCACGAGTTTCGACCGCCGATCGGCTT

[0060] The artificial...

Embodiment 2

[0076] This embodiment is the preparation of HEPCIDIN1-3 monoclonal antibody, which specifically includes the following steps:

[0077] S2-1: Mouse immunization

[0078]Healthy and well-developed female BALb / c mice aged 6-10 weeks were selected for immunization with recombinant human HEPCIDIN1-3 protein prepared by injection. The volume of the first intraperitoneal injection was 0.2mL / mouse, and the injection was repeated at intervals of 2 weeks. Three days before the fusion, the same dose was injected intravenously to boost the immunization once, so that the immune antibody level reached 1:64. Take the spleen of the immunized mouse, prepare the spleen cell suspension, suspend the cells with complete culture medium, add rHulL-2, rHulL-6, PWM and HEPCIDIN1-3, so that the final concentrations are 50U / mL, 500U / mL, 1200ug / mL and 500ug / mL in 5% CO 2 After culturing in a 37°C incubator for 5 days, the cells were harvested for fusion.

[0079] S2-2: Hybridoma selection

[0080] T...

Embodiment 3

[0097] This embodiment is a hepcidin latex-enhanced immune turbidimetric assay kit and its use method, specifically as follows:

[0098] The hepcidin latex enhanced immune turbidimetric assay kit described in this implementation includes reagent R1, reagent R2 and OC calibrator, and the specific components are as follows:

[0099] (1) Reagent R1 contains:

[0100] Tris-HCl buffer 50mM / L,

[0101] PEG6000···································· 20g / L,

[0102] BSA······································5g / L,

[0103] NaCl 9g / L,

[0104] MgCl 2 ····················································· 0.5g / L,

[0105] NaN 3 ····················································0.1g / L,

[0106] EDTA 0.5g / L;

[0107] (2) Reagent R2 contains:

[0108] Tris-HCl buffer 50mM / L,

[0109] BSA·································5g / L,

[0110] NaCl 9g / L,

[0111] Cross-linked balls······························ 5%,

[0112] TX-100····························································...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a latex enhanced turbidimetry detection kit for hepcidin (HEPCIDIN) prepared on the basis of a monoclonal antibody, which contains latex microspheres cross-linked and mixed with the HEPCIDIN 1-3 monoclonal antibody, and the latex microspheres cross-linked and mixed with the HEPCIDIN 1-3 monoclonal antibody are prepared by the steps of cutting a human HEPCIDIN protein gene sequence into three section, respectively introducing into expression bacteria through expression vectors for expression; purifying and identifying an expression product, then immunizing a mouse, taking the spleen aseptically after immunization reaches a specified antibody level, and preparing hybridoma cells; culturing and screening hybridoma, obtaining three HEPCIDIN monoclonal antibodies, and then respectively cross-linking the three HEPCIDIN monoclonal antibodies and polystyrene latex microspheres to form the latex microspheres. Compared with the prior art, the latex enhanced immunoturbidimetry kit is formed by cross-linking the three monoclonal antibodies to the latex microspheres, can be used for determining hepcidin on a full-automatic biochemical analyzer, is low in cost and high inautomation degree, saves the detection time and improves the application value of hepcidin detection.

Description

technical field [0001] The invention relates to a latex-enhanced turbidimetric method detection kit for hepcidin prepared based on a monoclonal antibody. Background technique [0002] An antigen is usually composed of multiple antigenic determinants. One antigenic determinant stimulates the body, and the antibody produced by a B lymphocyte stimulated by the antigen is called a monoclonal antibody, which is usually prepared by hybridoma technology. Hybridoma antibody technology is based on cell fusion technology, which fuses sensitized B cells with the ability to secrete specific antibodies and myeloma cells with unlimited reproductive capacity into B cell hybridomas. Using a single hybridoma cell with this characteristic to cultivate a cell population, a specific antibody against an antigenic epitope, that is, a monoclonal antibody, can be prepared. [0003] Hepcidin (HEPCIDIN) is a 25-amino acid peptide with the characteristics of antimicrobial peptides. It is the main reg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/74G01N33/577G01N33/543G01N33/531C07K16/26
CPCG01N33/74G01N33/577G01N33/54346G01N33/531C07K16/26G01N2333/575
Inventor 卞正虹王斌李秀艳
Owner 江苏沃兴生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com